Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7991

LOC631910 (LOC631910)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991
"Pseudo-wholemount" of euxassay_013145. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013145_01 euxassay_013145_02 euxassay_013145_03 euxassay_013145_04
EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991
euxassay_013145_05 euxassay_013145_06 euxassay_013145_07 euxassay_013145_08 euxassay_013145_09
EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991
euxassay_013145_10 euxassay_013145_11 euxassay_013145_12 euxassay_013145_13 euxassay_013145_14
EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991
euxassay_013145_15 euxassay_013145_16 euxassay_013145_17 euxassay_013145_18 euxassay_013145_19
EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991 EMAGE:7991
euxassay_013145_20 euxassay_013145_21 euxassay_013145_22 euxassay_013145_23 euxassay_013145_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7991Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7991_wholemount_strong.wlz
7991_wholemount_moderate.wlz
7991_wholemount_weak.wlz
7991_wholemount_possible.wlz
7991_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7991_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 08 09 10 11 12 13 15 17 18 19 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 17 18 19 20 21 22 23 24
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 08 09 10 11 12 13 15 17 18 19 20 21
tegmentum
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39543
Entity Detected:LOC631910, (LOC631910)
Sequence:sense strand is shown

>T39543
GGACTCAGCTCCATGTCTATCCGCTGGCCCGGCCGCTCTCTCGGAAGCCATGCCTGGATACTGATAGCCA
TGCTGCAGCTTGCGGTCGACTTCCCATCCTGTGACTCACTAGGCCCTGGGCCCGAGTTCCGGCTCCTGTC
ACGCCCACAGAGGCCCCAGCGGCTGTGGAGTCTGCGAAGTGGACCCCCAACGAGGCTACCGACACCGGCC
TGGAGTCCCCGTGCTGCCCGGGCAGAACGTGCCCACGGACCCATACAGATGCAGACTCCCCGTGCTCGGA
GGGCCCACAGGCCCAGGGACCAGGTAGCCACCCTCGGACCCAAAGGGGGACTCACCAAGCCCCCAGCTGC
CACCAGGTCGAGCCCTTCCCTCGCCTCTGCGACGGCCTCATCCTCCATAGTGACTGCTGGGGCTGCAGAG
CACCAGGGCCTCCTAAGACGGGGTAGGAGGCACACACATGATACAGAGTTCAACGATTTCGACTTCCGTG
GTGGCAGGCCCACGACAGAGACAGAATTCATAGCCTGGGGGCCTACGGGGGATGAGGACGCCCTGGAGTC
CAACACCTTCCCTGGTGGTTTCGGCCCCACCACGACTAAGGGGGTCACCGAGTCCCTGGATCCCTGGAAA
AGGACCCCTGTTGGGGTTAGCACAACGGAGCCTTCCACTAGTCCCAGCAGCAATGGGAAAGACATCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 78423. Forward Primer - name:078423_F_cDNA_LOC230959, sequence:GGACTCAGCTCCATGTCTATCC; Reverse Primer - name:078423_N_SP6_cDNA_LOC230959, sequence:CTGGATGTCTTTCCCATTGCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7993 same embryo
 EMAGE:7992 same embryo
 EMAGE:7990 same embryo
 EurExpress:euxassay_013145 same experiment
 MGI:4823054 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS