Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7995

D930030O05Rik RIKEN cDNA D930030O05 gene ( MGI:2443927)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995
"Pseudo-wholemount" of euxassay_016032. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016032_01 euxassay_016032_02 euxassay_016032_03 euxassay_016032_04
EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995
euxassay_016032_05 euxassay_016032_06 euxassay_016032_07 euxassay_016032_08 euxassay_016032_09
EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995
euxassay_016032_10 euxassay_016032_11 euxassay_016032_12 euxassay_016032_13 euxassay_016032_14
EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995
euxassay_016032_15 euxassay_016032_16 euxassay_016032_17 euxassay_016032_18 euxassay_016032_19
EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995 EMAGE:7995
euxassay_016032_20 euxassay_016032_21 euxassay_016032_22 euxassay_016032_23 euxassay_016032_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7995Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7995_wholemount_strong.wlz
7995_wholemount_moderate.wlz
7995_wholemount_weak.wlz
7995_wholemount_possible.wlz
7995_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7995_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 moderate expression: see section 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 09 10 17 18 20 21 22 23 moderate expression: see section 04 07 08 19
vagus x ganglion
strong strong
regionalstrong expression: see section 09 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 08
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 14 15 16 17 18 19
testis
weak weak
regionalweak expression: see section 05 17 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39697
Entity Detected:D930030O05Rik, RIKEN cDNA D930030O05 gene ( MGI:2443927)
Sequence:sense strand is shown

>T39697
GGAGCTCAAGGTCATTCTCAGTCACACATAAAATACTAGGCCAGCCTGGGCTACCTGAGACCTTGTCTCC
AGAAAAGAAAAAGGGGAAAGGAAAAAAAAAGAACTAATGTATTTTAAAGTTGGAGAACAGCCTTAGACCT
GCAGTGGACTGATGTCTACTTTTCATTTTGTAAAATATTTTGAACATTTCTATTTATCATTCATAATGCT
CTAAATAGAAGCAGAACACTGTAGCTCTCAGATCCTGGGACAGGCAGGTCATGAGGGCTCTGACTGTTTG
GGGACAGTCTGTGACTCTTGATGTTTTAAATGTAGCAATTATGGCCTTGAAAAACTGTAACTCTAATATT
GGCATTTGTTGGTCATCTCAGATGAACCCAAACTGACCATTGCTGTGTTTGGGTGAAACCTGATGCTTTT
GCTTTTTTTTCTCTGTTTGCTTTTTTCTCTATCATAAAAGTATTTAATTATAAAAATAAGTGCTTTTCAG
ATTTCCACCTTCAATATATTGACTGTGGGTTTCTGATGCAGCATCAGACTGGAGCAGCCTGTCCTTTGAG
GCCCAGTGTTTCCATGGCCTGGAAGGACCCTCTCCTGCCGTCAGTAACTTCTGTAGCTTCTTTCCTCCTA
GATGTTCTTCCCTGTCCACCAGTGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69592. Forward Primer - name:069592_F_cDNA_D930030O05Rik, sequence:GGAGCTCAAGGTCATTCTCAGT; Reverse Primer - name:069592_N_SP6_cDNA_D930030O05Rik, sequence:GTCACTGGTGGACAGGGAAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7997 same embryo
 EMAGE:7998 same embryo
 EMAGE:7999 same embryo
 EMAGE:7994 same embryo
 EMAGE:7996 same embryo
 EurExpress:euxassay_016032 same experiment
 MGI:4824214 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS