Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7999

C130070B15Rik RIKEN cDNA C130070B15 gene ( MGI:2444974)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999
"Pseudo-wholemount" of euxassay_016025. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016025_01 euxassay_016025_02 euxassay_016025_03 euxassay_016025_04
EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999
euxassay_016025_05 euxassay_016025_06 euxassay_016025_07 euxassay_016025_08 euxassay_016025_09
EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999
euxassay_016025_10 euxassay_016025_11 euxassay_016025_12 euxassay_016025_13 euxassay_016025_14
EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999
euxassay_016025_15 euxassay_016025_16 euxassay_016025_17 euxassay_016025_18 euxassay_016025_19
EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999 EMAGE:7999
euxassay_016025_20 euxassay_016025_21 euxassay_016025_22 euxassay_016025_23 euxassay_016025_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7999Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7999_wholemount_strong.wlz
7999_wholemount_moderate.wlz
7999_wholemount_weak.wlz
7999_wholemount_possible.wlz
7999_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7999_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 05 06
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 09 16 17 18 19 20 21 22 weak expression: see section 05 06 07
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 07
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 13 14 15 16 17 18 weak expression: see section 07
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
aorta
weak weak
regionalweak expression: see section 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39722
Entity Detected:C130070B15Rik, RIKEN cDNA C130070B15 gene ( MGI:2444974)
Sequence:sense strand is shown

>T39722
GCTCCACTTCAGGGACAGATACTTTCCCAGGATCCACAGGACGCCAGGAATGTGGAGCAGAGAGCAGAGA
GGTCCCCAGGGGCCAGGCGGTAAGGACCCTCACCCCGCCCCCCCCATTCTCTCTGCTCCCTGCTTCTGAT
GTGGACCTCAGGCCATTCCCTGCCCTTCCTGGGGCCTCTGGGCCTCAGCTTGTCCTCTGCAAAATGGGCA
GGCTTGCCTCTGGCCCACTTATCACACAGGTCCCATGGGAGCAAGCAAGCAGCTTGAACTGGCTATGTGT
ATTGAGCAGGAGACACTGCTGGGCTCCAAATTTCCCCATCCTACATTCCACGGGCAGATGTTCCCTATAT
CTGGGGTGATGGAAGATCCTGAAAGTAGAGGTTGTAAAGATGTGGGTGATATATAGGTTCCTGTAACTAT
GGGACCATTTCAAGACTGGATGTTAATGTGTGACAGTAGGGTTCACAATGTGTGGACATGTGACCGTGTG
ACTGGCTGTGGGGCCGGGAAGGGTCATACTTAAGATGAGAGTGGTGGCCCCCAAATGTAAGTTAAACTTC
TGGGAAGTGAGGCAAGAGACTCCCCCAAGTGAGCTGCTGCTGGGGGTGTGGCTCAGTGGTAGAGCCCCTG
CCTAGAATCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69897. Forward Primer - name:069897_F_cDNA_C130070B15Rik, sequence:GCTCCACTTCAGGGACAGATAC; Reverse Primer - name:069897_N_SP6_cDNA_C130070B15Rik, sequence:GGATTCTAGGCAGGGGCTCTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7997 same embryo
 EMAGE:7998 same embryo
 EMAGE:7994 same embryo
 EMAGE:7995 same embryo
 EMAGE:7996 same embryo
 EurExpress:euxassay_016025 same experiment
 MGI:4823530 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS