Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8010

Pdzrn4 PDZ domain containing RING finger 4 ( MGI:3056996)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010
"Pseudo-wholemount" of euxassay_013149. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013149_01 euxassay_013149_02 euxassay_013149_03 euxassay_013149_04
EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010
euxassay_013149_05 euxassay_013149_06 euxassay_013149_07 euxassay_013149_08 euxassay_013149_09
EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010
euxassay_013149_10 euxassay_013149_11 euxassay_013149_12 euxassay_013149_13 euxassay_013149_14
EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010
euxassay_013149_15 euxassay_013149_16 euxassay_013149_17 euxassay_013149_18 euxassay_013149_19
EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010 EMAGE:8010
euxassay_013149_20 euxassay_013149_21 euxassay_013149_22 euxassay_013149_23 euxassay_013149_24
EMAGE:8010 EMAGE:8010
euxassay_013149_25 euxassay_013149_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8010Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8010_wholemount_strong.wlz
8010_wholemount_moderate.wlz
8010_wholemount_weak.wlz
8010_wholemount_possible.wlz
8010_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8010_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 18 19 20 21 22 23 24 25 26
humerus
strong strong
regionalstrong expression: see section 06 moderate expression: see section 04
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 04
fibula
strong strong
regionalstrong expression: see section 01 24 25 26
tibia
strong strong
regionalstrong expression: see section 01 24 25
femur
strong strong
regionalstrong expression: see section 01 04 05 06 20 21 22 23 24 moderate expression: see section 02 03
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 12 16
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 15 16 17 18 weak expression: see section 10 11
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 13 14 15
metencephalon rest of alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 20
pons mantle layer
strong strong
regionalstrong expression: see section 12 13 14 15 moderate expression: see section 11
midbrain mantle layer
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 12
axial skeleton
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 16 17
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22
scapula
strong strong
regionalstrong expression: see section 05 moderate expression: see section 04
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39581
Entity Detected:Pdzrn4, PDZ domain containing RING finger 4 ( MGI:3056996)
Sequence:sense strand is shown

>T39581
TCCAGCGATGAGTGTAAGAGAATCGTGCTGCTCATCGCCAGGCCCGACATGCAGGTCCGAGCAAAGAGTG
GGATCTTAAGGCTACACTCTATACTCACCAAGTTCGTGAATGAATGTGCATGCGCTCCTGCTAGCCCTAT
CGGAACCAACTGCAGTTCTTTTAACCTGGGGCTGCGGGAGATAATGCGAACGCCAGCTGTGGATTATGCA
CTGGATGAAGGCTGGCTGGAAGATGAAAGGAACGAATTCTTAGAGGAGTTAAACTCAGAGCTGCTGGAGG
AAGACCATAATGAAGGAGCACAGCGCACAGCCTCTGAGCTGCAGCAGCCAAAAAAACAGGAGGAAGAAGA
AGGCACAACAGACACGGCCACCTCCTCTTCCAACAACCAGGAGAAGGACAGTGGCGTGGGGCGCACGGAT
GAGAGCTTGCGGAATGATGAGAGCTCAGAGCAGGAGAACGCAGTGGAGGAGCCCCACAGCACCACCCTGA
AGAGCAAGAGAGAGCTGGGGAAGAGCCAAGACACGCTAGGGAGCCTTGAGCATCAATGCAGTGAGAGTTG
TGCTGGGGGTGAGTGCTTAGACTCCGACTGTGCCAGCAACCAGGAGGTGTGTGAAGGCTTCCAGCAGCTG
TTGGAGCTTAAGATTCGAAACCACGGAGATTACGACCTGTACTACTCAAGCAGTACCATCGAGTGCAATC
GAGGGGAACAGGATGGGGTGGAGCACGAGCTGCAGCTGCTTAACGAGGAGCTGCGAAACATTGAGCTAGA
GTGCCAGAACATCATGCAGGCCCACAGGCTCCAGAAAGTGACGGACCAATACGGAGACATCTGGGCATTG
CATGATGGGGGATTCCGAAATTACAACACCAGCCTGGATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88041. Forward Primer - name:088041_F_cDNA_Pdzrn4, sequence:TCCAGCGATGAGTGTAAGAGAA; Reverse Primer - name:088041_N_SP6_cDNA_Pdzrn4, sequence:CATCCAGGCTGGTGTTGTAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8007 same embryo
 EMAGE:8011 same embryo
 EMAGE:8006 same embryo
 EMAGE:8008 same embryo
 EMAGE:8009 same embryo
 EurExpress:euxassay_013149 same experiment
 MGI:4827146 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS