Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:802

Otx2 orthodenticle homolog 2 (Drosophila) ( MGI:97451)
TS11 (7.75 dpc)
in situ hybridisation

Data Images
EMAGE:802
Fig 2N Acampora et al, 1995 [PMID:7588062] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:802EMAGE:802Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
802_voxel_strong_3D_1.wlz
802_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:802_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo mesoderm
detected detected
regionalExpression is restricted to the anterior one third of the embryo
embryo endoderm
detected detected
regionalExpression is restricted to the anterior one third of the embryo
embryo ectoderm
detected detected
regionalExpression is restricted to the anterior one third of the embryo
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1331375
Entity Detected:Otx2, orthodenticle homolog 2 (Drosophila) ( MGI:97451)
Sequence:sense strand is shown

>MGI:1331375
GCCAGTTCAGTCCCCCCTCTAGTACCTCAGTCCCAACCATTGCCAGCAGCAGTGCTCCAGTGTCTATCTG
GAGCCCAGCGTCCATCTCCCCACTGTCTGACCCCTTGTCCACTTCCTCCTCCTGCATGCAGAGGTCCTAT
CCCATGACCTATACTCAGGCTTCAGGTTATAGTCAAGGCTATGCTGGCTCAACTTCCTACTTTGGGGGCA
TGGACTGTGGATCTTATTTGACCCCTATGCATCACCAGCTTCCTGGACCAGGGG
nt 718 - nt 981 of NM_144841.1
Notes:The probe used in this study by Acampora et al, 1995 [PMID:7588062] was originally described by Simeone et al., 1993 [PMID:8101484] as "a 263 nucleotide HaeIII fragment" (see Figure 1a therein).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:7.75 dpc
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Acampora et al, 1995 [PMID:7588062] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7588062] Acampora D, Mazan S, Lallemand Y, Avantaggiato V, Maury M, Simeone A, Brulet P 1995 Forebrain and midbrain regions are deleted in Otx2-/- mutants due to a defective anterior neuroectoderm specification during gastrulation. Development (121):3279-90
 [ PMID:8101484] Simeone A, Acampora D, Mallamaci A, Stornaiuolo A, D'Apice MR, Nigro V, Boncinelli E 1993 A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J (12):2735-47
Links:MGI:1336361 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI