Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8064

Fat3 FAT tumor suppressor homolog 3 (Drosophila) ( MGI:2444314)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064
"Pseudo-wholemount" of euxassay_015982. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015982_01 euxassay_015982_02 euxassay_015982_03 euxassay_015982_04
EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064
euxassay_015982_05 euxassay_015982_06 euxassay_015982_07 euxassay_015982_08 euxassay_015982_09
EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064
euxassay_015982_10 euxassay_015982_11 euxassay_015982_12 euxassay_015982_13 euxassay_015982_14
EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064
euxassay_015982_15 euxassay_015982_16 euxassay_015982_17 euxassay_015982_18 euxassay_015982_19
EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064 EMAGE:8064
euxassay_015982_20 euxassay_015982_21 euxassay_015982_22 euxassay_015982_23 euxassay_015982_24
EMAGE:8064 EMAGE:8064
euxassay_015982_25 euxassay_015982_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8064Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8064_wholemount_strong.wlz
8064_wholemount_moderate.wlz
8064_wholemount_weak.wlz
8064_wholemount_possible.wlz
8064_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8064_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 06 07 08 09 10 11 12 17 18 19 20 21 22 23 24
diaphragm
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 09 22 weak expression: see section 08
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 07 09 22 weak expression: see section 08
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 25
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 07 22 weak expression: see section 08
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 25 weak expression: see section 08
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 07 22 weak expression: see section 08
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 25 weak expression: see section 08
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 22
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 25
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 10 23
femur
moderate moderate
regionalmoderate expression: see section 08 09 21 weak expression: see section 06 07 22 23
axial musculature
moderate moderate
regionalmoderate expression: see section 03 23 25 26 weak expression: see section 02 04 05 06 07 22 24
thymus primordium
weak weak
regionalweak expression: see section 12 13 14 15 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 05 23 weak expression: see section 06 21 22
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 15 16 17 18 moderate expression: see section 13 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 14
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 moderate expression: see section 13 24 25
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 16 19 20 21 22 23 moderate expression: see section 14
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 17
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19 moderate expression: see section 15 16
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 10
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 13 15 16
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 14
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 06 17 18 moderate expression: see section 07 19 20
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 22 moderate expression: see section 21
pons mantle layer
strong strong
regionalstrong expression: see section 07 08 09 11 18 moderate expression: see section 10 12 13 15 16 19 20
pons ventricular layer
strong strong
regionalstrong expression: see section 11 13 14 moderate expression: see section 10 12
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 15 16 17 18 19 20 moderate expression: see section 13 14
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 15 16 17 moderate expression: see section 13 14
facial vii ganglion
weak weak
regionalweak expression: see section 05
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
spinal cord mantle layer
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18
dorsal root ganglion
strong strong
single cellstrong expression: see section 10 11 12 17 18 19
saccule
moderate moderate
regionalmoderate expression: see section 08 09 10 18 19 20 21
tongue muscle
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 17 18 19 20 21 22 23 24
upper lip
moderate moderate
regionalmoderate expression: see section 14 15
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 17 18 19 20 21 22
renal cortex
weak weak
regionalweak expression: see section 08 09 10 11 18 19 20 21
urethra of male
moderate moderate
regionalmoderate expression: see section 14 15 16
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 26
vault of skull
strong strong
regionalstrong expression: see section 26 moderate expression: see section 01 23 24 25
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 21 26 moderate expression: see section 01 02 04 22 23 24 25
clavicle
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 10 18 19 20
sternum
weak weak
regionalweak expression: see section 15 16
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 10 11 12 18 19 20
tail mesenchyme
weak weak
regionalweak expression: see section 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39633
Entity Detected:Fat3, FAT tumor suppressor homolog 3 (Drosophila) ( MGI:2444314)
Sequence:sense strand is shown

>T39633
CCTGGACATTAATGACAACCCTCCTGTGTTTGAAAGGAGAGACTACCTGGTAACAGTGCCTGAGGACACT
TCCCTTGGCACCCAAGTCCTGTCTGTTTTTGCCACCAGCAAAGATATTGGTACAAATGCTGAGATAACTT
ACCTCATCCGGTCTGGAAACGAACAAGGGAAATTTAGCATTAACCCAAAGACAGGGGGTATTTCTGTCTT
GGAAGCTCTGGACTATGAAACGTGCAGAAGATTTTACCTGGTGGTGGAAGCTAAAGATGGGGGCACCCCA
GCCCTCAGCACTGCAGCCACAGTCAGCATTGACCTCACAGATGTAAATGATAACCCTCCTCGGTTCAGCC
AAGATGTCTATAGTGCTGTCATCAGTGAAGATGCCTTAGAGGGGGACTCTGTCATTCTGCTGATAGCAGA
AGATGTGGACAGCAAGCCTAATGGACAGATTCGTTTTTCCATTGTGGGTGGAGATAGGGACAATGAATTT
GCTGTTGATCCCATCTTGGGACTTGTGAAAGTTAAGAAGAAACTGGACCGGGAGCGGGTGTCAGGATATT
CCCTGCTCATCCAGGCAGTAGATAGTGGCATTCCTGCAATGTCCTCAACGACAACTGTCAACATTGATAT
TTCTGATGTGAATGACAACAGTCCAGTGTTTACACCTGCCAACTACACTGCTGTGATTCAGGAAAATAAG
CCAGTGGGTACCAGCATCTTACAGCTTGTGGTGACAGACAGAGACTCGTTTCACAATGGGCCTCCCTTTT
CCTTCTCTATTTTGTCGGGAAATGAAGACGAGGAGTTCATGCTGGACTCCCATGGGATCCTACGGTCTGC
AGTGGTCTTCCGGCACATGGAGTCTCCAGAATACCTACTGTGCATCCAGGCAAAAGACTCAGGAAAACCA
CAGCAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81748. Forward Primer - name:081748_F_cDNA_LOC382129, sequence:CCTGGACATTAATGACAACCCT; Reverse Primer - name:081748_N_SP6_cDNA_LOC382129, sequence:CTTGCTGTGGTTTTCCTGAGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8067 same embryo
 EMAGE:8069 same embryo
 EMAGE:8068 same embryo
 EMAGE:8066 same embryo
 EMAGE:8065 same embryo
 EurExpress:euxassay_015982 same experiment
 MGI:4824786 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS