Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8066

Myo3b myosin IIIB ( MGI:2448580)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066
"Pseudo-wholemount" of euxassay_015994. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015994_01 euxassay_015994_02 euxassay_015994_03 euxassay_015994_04
EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066
euxassay_015994_05 euxassay_015994_06 euxassay_015994_07 euxassay_015994_08 euxassay_015994_09
EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066
euxassay_015994_10 euxassay_015994_11 euxassay_015994_12 euxassay_015994_13 euxassay_015994_14
EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066
euxassay_015994_15 euxassay_015994_16 euxassay_015994_17 euxassay_015994_18 euxassay_015994_19
EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066 EMAGE:8066
euxassay_015994_20 euxassay_015994_21 euxassay_015994_22 euxassay_015994_23 euxassay_015994_24
EMAGE:8066 EMAGE:8066
euxassay_015994_25 euxassay_015994_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8066Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8066_wholemount_strong.wlz
8066_wholemount_moderate.wlz
8066_wholemount_weak.wlz
8066_wholemount_possible.wlz
8066_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8066_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
weak weak
regionalweak expression: see section 06 07 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 09 10 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 18 19 21 22
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 13 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39627
Entity Detected:Myo3b, myosin IIIB ( MGI:2448580)
Sequence:sense strand is shown

>T39627
ATTTAGGAGATGGAGGAGGGAAGATCAGAAGCCCAAGGTCAGCCTTGGCTACACAAGGACCTGAGGCCAG
CCTGGCGCACAGGAGAACTTGTAAAGCTAATAAGGTCTATTAGAATCAGCGTGGCACAGAGGCACATGCC
TGAAGTCCCAGCACTTAGATGATCAAGCTCCAGGCCAACAAGGCAACAGAGGAAGACTCAAACCCCATCA
TCTCCCCTGCGAAAGAGAGAAAAGTGAAAGAACAGACAAGCTTGAAACTTCAGAAATACCCACCCTTATC
GCCTTCCTCAGTTTGAACTATTATTGTGGAAGAAATTGTCATTGATATTAACCATAAAACTTGTACTTAG
GCAGTGGTGGTCTACAAGCGACATGGCTCTGGTGCCTTTTGTCCCCACTTCCTTCCAGAAGCCCTCCCAC
CTGGTGTGCTTGCAAACAGCTTCTGTCTTCCTCCCCTGTTTTCCCTGAGGAATAGAAGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 76592. Forward Primer - name:076592_F_cDNA_Myo3b, sequence:ATTTAGGAGATGGAGGAGGGAA; Reverse Primer - name:076592_N_SP6_cDNA_Myo3b, sequence:CACTTCTATTCCTCAGGGAAAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8067 same embryo
 EMAGE:8069 same embryo
 EMAGE:8064 same embryo
 EMAGE:8068 same embryo
 EMAGE:8065 same embryo
 EurExpress:euxassay_015994 same experiment
 MGI:4826563 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS