Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8067

Slc35e1 solute carrier family 35, member E1 ( MGI:2142403)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067
"Pseudo-wholemount" of euxassay_015962. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015962_01 euxassay_015962_02 euxassay_015962_03 euxassay_015962_04
EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067
euxassay_015962_05 euxassay_015962_06 euxassay_015962_07 euxassay_015962_08 euxassay_015962_09
EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067
euxassay_015962_10 euxassay_015962_11 euxassay_015962_12 euxassay_015962_13 euxassay_015962_14
EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067
euxassay_015962_15 euxassay_015962_16 euxassay_015962_17 euxassay_015962_18 euxassay_015962_19
EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067 EMAGE:8067
euxassay_015962_20 euxassay_015962_21 euxassay_015962_22 euxassay_015962_23 euxassay_015962_24
EMAGE:8067 EMAGE:8067
euxassay_015962_25 euxassay_015962_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8067Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8067_wholemount_strong.wlz
8067_wholemount_moderate.wlz
8067_wholemount_weak.wlz
8067_wholemount_possible.wlz
8067_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8067_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 15 22 23 25 26
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 20 weak expression: see section 08 18 19 21
vibrissa
weak weak
regionalweak expression: see section 07 08 09 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 21 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 moderate expression: see section 21
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 08 09 10 moderate expression: see section 18 19 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 10 moderate expression: see section 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 16 17 weak expression: see section 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 17 18 19 moderate expression: see section 12 weak expression: see section 13
inner ear
moderate moderate
regionalmoderate expression: see section 04 05 weak expression: see section 23 24 25 26
otic capsule
weak weak
regionalweak expression: see section 07 08 09 10 19 20
mandible
strong strong
regionalstrong expression: see section 04 05 23 24 moderate expression: see section 06 07 09 10 11 12 18 19 20 21 22 weak expression: see section 08
lower jaw incisor
weak weak
regionalweak expression: see section 16 17
maxilla
moderate moderate
regionalmoderate expression: see section 07 09 10 18 19 20 21 weak expression: see section 08
upper jaw incisor
weak weak
regionalweak expression: see section 16 17
vault of skull
moderate moderate
regionalmoderate expression: see section 24 weak expression: see section 01 02 25
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 moderate expression: see section 04 22 23 24 weak expression: see section 01 02 03 06 21 25 26
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 11 18
sternum
moderate moderate
regionalmoderate expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39632
Entity Detected:Slc35e1, solute carrier family 35, member E1 ( MGI:2142403)
Sequence:sense strand is shown

>T39632
CTAGAATACCCCAAGGCAGTTGGCCACTTGCAGCTAGTGCTGCCCAAGGGCAGACTTATAGTGACCATCA
GCCCATCAGCTGTGACCTTCCTCTGCCTTGTGGGTGCCAAAGCAGGGCCTGGGGGGCCCTTGGACTCTAG
AGGAGCAGCTTGTCTGCTCCCCACTCTCCTGATGGCACAGAAGGCCAAGGAGTGGTGATGACAGTTTCCT
CAGAACCTAAGTTTCTCTGGGGAACATCTTGTCGGCCATGGGATGGAAACCATCTTGTCTCATTTCAAAA
TATGGGATGTTTGTTGCTGGAGCCAGTCCCTCCCAGGTCAGTGGTAGCAGGCAATGCCGAAGGGTACTGA
AGTTGCAGCCACAGAGGTAGAAGGAGGTATTCATACCCGAGTACAGTGTTGCTTGTCAGTGAGGAGACCG
CATGTGTATCAGGGTTTTAACTGTGCTCTGGCAAATGGGACACCAGGCAGGTCTTGGTTTTTTAGTTAAG
AATCACTTTGAGGCTGGGTAGAGTGCCTGTCTAGCATTCGTGCAGCCTTAGATTCTGTCCACAGAATGCC
ACGCAGTGGTACAGGCCTGCCTGCCTTCCTAGCACTCTTAAAGCAGATTCAGGAGGATCTAGAGGACAAG
GTTCTCTACAAAGTAAGTTCCAGACCAGCCTGGGCTTCAATGAGAAGCTGCCTCAGGAAAATGATCAGTT
TAGGGACCTGCCATAGTGGCATATATCGAGGGGCTGAGGCAGGAAGATGGCCATGGGTTTAAAGTCAGTC
TGGGTTACATAATGAGACTCTCTCTGAAAAAGTTGAGGGGCTGGTGGCCCATACCTATGGTCTTAGGTAC
TCTTGAAGCAGAAGCAAGAGACTTCCCCAAGCCTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105402. Forward Primer - name:105402_F_cDNA_6030458H05, sequence:CTAGAATACCCCAAGGCAGTTG; Reverse Primer - name:105402_N_SP6_cDNA_6030458H05, sequence:ACAGGCTTGGGGAAGTCTCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8069 same embryo
 EMAGE:8064 same embryo
 EMAGE:8068 same embryo
 EMAGE:8066 same embryo
 EMAGE:8065 same embryo
 EurExpress:euxassay_015962 same experiment
 MGI:4828201 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS