Type: | in situ hybridisation probe |
Identifier: | MGI:2445479 |
Entity Detected: | Rapgef1, Rap guanine nucleotide exchange factor (GEF) 1 ( MGI:104580) |
Notes: | The Rapgef1 (C3G) probe used in this study by Voss et al., 2003 [PMID:12466202] is described as being "PCR generated using 5' CGCCCCTGCTTCTCAATGGTTAGCC 3' and 5' CCATCCAAGAAGGGAAAGCCAGCCG 3' and was complementary to 431 bases spanning exons 2-5 of the C3G locus." These primers correspond to nt 378-922 of NM_054050.1/AF348669.1, however the resulting sequence is greater than 431 bases (544). The probe is denoted as probe 2 in Fig 1A therein. |
Chemistry: | RNA |
Strand: | antisense |
Label: | S35 |