Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:809

Rapgef1 Rap guanine nucleotide exchange factor (GEF) 1 ( MGI:104580)
TS20 (12.5 dpc)
in situ hybridisation

Data Images
EMAGE:809 EMAGE:809 EMAGE:809 EMAGE:809
Figure 3E of Voss et al., 2003 [PMID:12466202] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 3F of Voss et al., 2003 [PMID:12466202] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. igure 3G of Voss et al., 2003 [PMID:12466202] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. igure 3H of Voss et al., 2003 [PMID:12466202] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
F is a brightfield image of the section shown in E. G and H are dark- and bright-field images of the sense control from the same embryo. Authors describe the expression pattern as ubiquitous.
Expression Pattern Description
Spatial Annotation:
EMAGE:809EMAGE:809Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
809_voxel_strong_3D_1.wlz
809_voxel_moderate_3D_1.wlz
809_voxel_possible_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:809_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
regionalAuthors report ubiquitous expression.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2445479
Entity Detected:Rapgef1, Rap guanine nucleotide exchange factor (GEF) 1 ( MGI:104580)
Notes:The Rapgef1 (C3G) probe used in this study by Voss et al., 2003 [PMID:12466202] is described as being "PCR generated using 5' CGCCCCTGCTTCTCAATGGTTAGCC 3' and 5' CCATCCAAGAAGGGAAAGCCAGCCG 3' and was complementary to 431 bases spanning exons 2-5 of the C3G locus." These primers correspond to nt 378-922 of NM_054050.1/AF348669.1, however the resulting sequence is greater than 431 bases (544). The probe is denoted as probe 2 in Fig 1A therein.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:12.5 dpc
Theiler Stage:TS20
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Voss et al., 2003 [PMID:12466202] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/dev.00217] [ PMID:12466202] Voss AK, Gruss P, Thomas T 2003 The guanine nucleotide exchange factor C3G is necessary for the formation of focal adhesions and vascular maturation. Development (130):355-67
Links:MGI:2445479 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI