Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8136

Rhob ras homolog gene family, member B ( MGI:107949)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136
"Pseudo-wholemount" of euxassay_016450. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016450_01 euxassay_016450_02 euxassay_016450_03 euxassay_016450_04
EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136
euxassay_016450_05 euxassay_016450_06 euxassay_016450_07 euxassay_016450_08 euxassay_016450_09
EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136
euxassay_016450_10 euxassay_016450_11 euxassay_016450_12 euxassay_016450_13 euxassay_016450_14
EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136
euxassay_016450_15 euxassay_016450_16 euxassay_016450_17 euxassay_016450_18 euxassay_016450_19
EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136 EMAGE:8136
euxassay_016450_20 euxassay_016450_21 euxassay_016450_22 euxassay_016450_23 euxassay_016450_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8136Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8136_wholemount_strong.wlz
8136_wholemount_moderate.wlz
8136_wholemount_weak.wlz
8136_wholemount_possible.wlz
8136_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8136_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata floor plate
weak weak
regionalweak expression: see section 12 13 14
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 16 17
metencephalon floor plate
weak weak
regionalweak expression: see section 13
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 06 08 10 11 12
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21
pons mantle layer
weak weak
regionalweak expression: see section 08 18
spinal cord floor plate
weak weak
regionalweak expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63184
Entity Detected:Rhob, ras homolog gene family, member B ( MGI:107949)
Sequence:sense strand is shown

>T63184
GAGGATGGGGCTGTTACATAAATACAGATTTTATTTTCGGAGGCAGAATGGTATTGTTTAGTGGTGTGTG
GGGCGACCAGGGCCCAGAGCAGCTCCTTTCCCAGGCTGGGTCAGGCGCCCACCCATCCAAGCATGAACTG
GACTTGGCCATCTTTCCACACCCTGGGGAAGACATTTGCAACTGACTTGGGGTCGAGAGGAAGCAGCTCA
GACAGTGTCTCCTGGGCCAACCCCCAGCGAACCTCCGGCAGAGGATCCAGGGTGTGCAGTGGGGTCACTT
TTGCCATAAGCGAACTTTGTGCCTGTCCTACAAATGAACATTGTTCAGCTCAAGAGACTATTGTTACTGA
ATTTATTTAAACGCTGAAGCTTTTTGTTGTTGATGAAAGAGTTCTTTGCACAATTGTCCCATTGTTTGAC
ACCCAGTGTACTTGTCATTTGCATAAGACAGCATTCTGACCACACTTGTATGCTGTAACCTCATCTACTT
CTGATGGTTTTTTTAAAACTATGATGACTCTAAGATTACAAAAACAACTAACTTTTGCTTTGTTTTCTTG
AAAAAAAAATGTCAACAGTGTGAATTTTTTCTTTAAATTTGTGTAGCATACGCAGTTTTGGTAAAGGAAG
GCAACAGGTATTGGGGTCTATTTAAACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 146661. Forward Primer - name:146661_F_cDNA_Rhob, sequence:GAGGATGGGGCTGTTACATAAA; Reverse Primer - name:146661_N_SP6_cDNA_Rhob, sequence:GGGTTTAAATAGACCCCAATACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8138 same embryo
 EMAGE:8137 same embryo
 EMAGE:8134 same embryo
 EMAGE:8135 same embryo
 EurExpress:euxassay_016450 same experiment
 MGI:4827732 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS