Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8191

Scn5a sodium channel, voltage-gated, type V, alpha ( MGI:98251)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191
"Pseudo-wholemount" of euxassay_007541. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007541_01 euxassay_007541_02 euxassay_007541_03 euxassay_007541_04
EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191
euxassay_007541_05 euxassay_007541_06 euxassay_007541_07 euxassay_007541_08 euxassay_007541_09
EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191
euxassay_007541_10 euxassay_007541_11 euxassay_007541_12 euxassay_007541_13 euxassay_007541_14
EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191
euxassay_007541_15 euxassay_007541_16 euxassay_007541_17 euxassay_007541_18 euxassay_007541_19
EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191 EMAGE:8191
euxassay_007541_20 euxassay_007541_21 euxassay_007541_22 euxassay_007541_23 euxassay_007541_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8191Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8191_wholemount_strong.wlz
8191_wholemount_moderate.wlz
8191_wholemount_weak.wlz
8191_wholemount_possible.wlz
8191_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8191_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 17 18 19 21 22 23 24 weak expression: see section 20
humerus
strong strong
regionalstrong expression: see section 02 24 moderate expression: see section 01 03 04 23
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 05
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 05 23
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 05 23
fibula
moderate moderate
regionalmoderate expression: see section 01 24
tibia
moderate moderate
regionalmoderate expression: see section 01 02 24
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 17 18 19 20 21 22 23 24
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 03 04 05 06 07 08 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 23 24
anterior naris
strong strong
regionalstrong expression: see section 10 13
external naris
strong strong
regionalstrong expression: see section 09 14 15
nasal septum
weak weak
regionalweak expression: see section 10 12 13
hyoid
weak weak
regionalweak expression: see section 10 11 12 13 14
meckel's cartilage
strong strong
regionalstrong expression: see section 08 09 10 14 15 16 17 18 19 moderate expression: see section 02 03 04 05 06 07 11 13 20 21 22
axial skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
basioccipital bone
weak weak
regionalweak expression: see section 06 07 19 20 21
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
exoccipital bone
weak weak
regionalweak expression: see section 04 05 06
temporal bone petrous part
weak weak
regionalweak expression: see section 01 02 03 04 05 06 20 21 22 23 24
vault of skull
weak weak
regionalweak expression: see section 01 02 03 04 05 06 20 21 22 23 24
orbito-sphenoid
weak weak
regionalweak expression: see section 04 05 06 17 18 19 20 21 22 23 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
clavicle
weak weak
regionalweak expression: see section 06 07 08 09 17 18
scapula
strong strong
regionalstrong expression: see section 02 23 24 moderate expression: see section 03 04 22
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 08 15 16
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35295
Entity Detected:Scn5a, sodium channel, voltage-gated, type V, alpha ( MGI:98251)
Sequence:sense strand is shown

>T35295
GAAGATCCAGATGGAGGAGAAATTCATGGCGGCCAATCCTTCCAAGATCTCCTATGAGCCCATCACCACC
ACCCTGCGGCGAAAACATGAGGAGGTGTCGGCCACGGTCATCCAGCGGGCCTTCCGGAGGCACCTCCTGC
AGCGCTCGGTGAAGCATGCTTCCTTCCTCTTCCGCCAGCAAGCGGGCAGCAGTGGCCTCTCTGATGAGGA
TGCCCCCGAGCGAGAGGGACTCATTGCCTACATGATGAATGAGAACTTCTCCCGGCGCAGCGGTCCCCTC
TCCAGCTCTTCCATCTCCTCCACGTCCTTCCCACCGTCCTATGACAGCGTCACGAGGGCCACCAGTGATA
ACCTCCCAGTGCGTGCGTCGGACTACAGCCGCAGCGAAGATCTTGCAGACTTCCCTCCATCTCCAGATAG
GGACCGAGAGTCTATAGTGTGAACCTGGCCACCCGTCCGGCCAGGACGTGCCCTGTTGTATCCTGACAAA
CCTTAAGCAGTTGAAACCAGTGTCGGCTAAGGCCTTCCTAGCTCTGGAGGTGACAGGGGAACCTCCAGGT
GGAGGAACCACACGGCAGAGTTCTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90956. Forward Primer - name:090956_F_cDNA_Scn5a, sequence:GAAGATCCAGATGGAGGAGAAA; Reverse Primer - name:090956_N_SP6_cDNA_Scn5a, sequence:ACAGAACTCTGCCGTGTGGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8190 same embryo
 EMAGE:8193 same embryo
 EMAGE:8192 same embryo
 EurExpress:euxassay_007541 same experiment
 MGI:4827904 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS