Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:820

Hoxb8 homeobox B8 ( MGI:96189)
TS15 (24 Somite no.)
in situ hybridisation

Data Images
EMAGE:820
Figure 1A of van den Akker et al., 2001 [PMID:11311170] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Abbreviations used: s, somite; FL, forelimb bud.
Expression Pattern Description
Spatial Annotation:
EMAGE:820Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
820_wholemount_strong_3D_1.wlz
820_wholemount_moderate_3D_1.wlz
820_wholemount_weak_3D_1.wlz
820_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:820_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
somite 11
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22. Expression is weak in anterior region of somite 11.
somite 12
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 13
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 14
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 15
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 16
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 17
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 18
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 19
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 20
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 21
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
somite 22
strong strong
Authors state that expression is quite strong in the paraxial mesoderm between somites 11 and 22.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1339294
Entity Detected:Hoxb8, homeobox B8 ( MGI:96189)
Sequence:sense strand is shown

>MGI:1339294
TCGGCCCCGCGAGCGACGCAGGAGCTGGGCCTCCCACAGCAGCGTCCCCCGCCGCGCCAGTCCCCGCTAG
TGGTAGTATCTCGTAATAGCTTCTGTGTGTGAGCTACCGTGGATCTCCTTCCCTTGCTTCTGTGTGTGAG
CTACCGTGGATCTCCTTCCCTTCTCTTGGGGGTCCGGGGGGAAAAAAAGAAAAGGATTTTAAGCAAGGAC
TCTTAAGCAAGGACTCCCTCGTCCTGCGAGGGTGATCGACTGCGGCCTGGCAGAACCCCCTCGCCCCCGC
CCCATGTAAAAAAGCCTCCTTGTGCAATGGTCTGTTTCCTTTGAACGTGCTTCTTTGTAATGACCGAGGT
AC
nt 1886 - nt 2237 of NM_010461.1
Notes:The probe used in study by van den Akker et al., 2001 [PMID:11311170] is defined as a "350 bp SacI-KpnI" fragment.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:24 Somite no.
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:van den Akker et al., 2001 [PMID:11311170] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11311170] van den Akker E, Fromental-Ramain C, de Graaff W, Le Mouellic H, Brulet P, Chambon P, Deschamps J 2001 Axial skeletal patterning in mice lacking all paralogous group 8 Hox genes. Development (128):1911-21
Links:MGI:1934249 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI