Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8260

Grem1 gremlin 1 ( MGI:1344337)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260
"Pseudo-wholemount" of euxassay_007295. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007295_01 euxassay_007295_02 euxassay_007295_03 euxassay_007295_04
EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260
euxassay_007295_05 euxassay_007295_06 euxassay_007295_07 euxassay_007295_08 euxassay_007295_09
EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260
euxassay_007295_10 euxassay_007295_11 euxassay_007295_12 euxassay_007295_13 euxassay_007295_14
EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260 EMAGE:8260
euxassay_007295_15 euxassay_007295_16 euxassay_007295_17 euxassay_007295_18 euxassay_007295_19
EMAGE:8260 EMAGE:8260 EMAGE:8260
euxassay_007295_20 euxassay_007295_21 euxassay_007295_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8260Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8260_wholemount_strong.wlz
8260_wholemount_moderate.wlz
8260_wholemount_weak.wlz
8260_wholemount_possible.wlz
8260_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8260_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 17 18 19 20
nasal septum
weak weak
regionalweak expression: see section 14
meckel's cartilage
strong strong
regionalstrong expression: see section 07 08 09 10 13 14 15 16 17 18 19 moderate expression: see section 03 04 05 06 11 12 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
basioccipital bone
moderate moderate
regionalmoderate expression: see section 04 05 06 18 19 20
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 18 19
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 16 17 18 19 20 21 22
frontal bone primordium
moderate moderate
regionalmoderate expression: see section 01
parietal bone
moderate moderate
regionalmoderate expression: see section 01 02
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 20
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 01 02 03
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 08 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1865
Entity Detected:Grem1, gremlin 1 ( MGI:1344337)
Sequence:sense strand is shown

>T1865
TGGCCTCGAGGCCAGATTCGGCACGAGGAATTAATTCACTTGACCGCGGGTGTAAGTCTTTTGTCTTGTG
AAGAACCTTCAGAATGTGGGGAGACACGTGGTGATGGCAAACGGGACAGAGGACTGACGCAGGAACGGTC
AGGCTGAGGACCAGTCTGGGCCAGTGAAATTCAGTAGTGAGATGTCTAGAGTTTAAAAGTTGTTTCCCAA
AACAATATTAGTCTTGTTTTTAGCAAAAGGGTTTTCCTGATATTTAAAAGAACCCAGACACACAGAGGAA
AAATATAATCAGCAAAAAAACAAAACAAAACAAAATAACACAACAATAACAACAACAACAAACAAAAACC
CAATTCTCTGTGCCAGCTTCTGTGACCTACTGATACTAGCTGTAACTGATACTAGCTGTTAAGGGTGAAA
TGCTGACCACTCCTGTTTTAAGAACCAAGTGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:596225 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:596225 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8258 same embryo
 EMAGE:8259 same embryo
 EurExpress:euxassay_007295 same experiment
 MGI:4825220 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS