Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8287

AK129341 cDNA sequence AK129341 ( MGI:2680221)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287
"Pseudo-wholemount" of euxassay_007711. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007711_01 euxassay_007711_02 euxassay_007711_03 euxassay_007711_04
EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287
euxassay_007711_05 euxassay_007711_06 euxassay_007711_07 euxassay_007711_08 euxassay_007711_09
EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287
euxassay_007711_10 euxassay_007711_11 euxassay_007711_12 euxassay_007711_13 euxassay_007711_14
EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287
euxassay_007711_15 euxassay_007711_16 euxassay_007711_17 euxassay_007711_18 euxassay_007711_19
EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287 EMAGE:8287
euxassay_007711_20 euxassay_007711_21 euxassay_007711_22 euxassay_007711_23 euxassay_007711_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8287Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8287_wholemount_strong.wlz
8287_wholemount_moderate.wlz
8287_wholemount_weak.wlz
8287_wholemount_possible.wlz
8287_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8287_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 12 13 14
choroid invagination
strong strong
regionalstrong expression: see section 07 20 moderate expression: see section 08 09 10 11 15 16 19 weak expression: see section 17 18
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 20 moderate expression: see section 08 09 10 11 14 15 16 19 21 22 weak expression: see section 17 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35915
Entity Detected:AK129341, cDNA sequence AK129341 ( MGI:2680221)
Sequence:sense strand is shown

>T35915
GACACCAAAAGGCAGAAACTGTTAGAGATAGTATTGAATTAACAAAACAGAAAGGGAAAGGTGCAGAAAT
ATCAAAGACTAGTAAAAAACTGCGGTGGTTTGATGAAAGTGCTAACTTAGAAAATGCTGTAGATGATTGC
CACCCAGTGAGGAACAGAGCAGGAATGGCTCCACGGTGGTTACAGCGCTGTCACACCAACAGTGGCACCT
ACAACCTGACAAGTATTCCTGAGTGTCCTGTACATTCTGCTGCTGGAAAGAAAGCCAAGGCTGATTCTGT
CCCAGAAAATGCTACTGATTTAGGAAGATATGAAATAGACAGTGTGCCTTTGAACTCTTCTGTATCTTTA
GGCTTTAGCTTTGCCAAACAAGCCTGGTCGGCCTGCAGAAGAGGAGAGAGCAAAGCCCCTGTACATGCTA
GTGACTCTAAGACTCAAAAGACTAAGCCTCAGAGAGGAGTAAAATTCACTAGAAGAACAGGGTCTTCAAA
GGTCCAGAAAGGACTTGTGCAGAACAGAAAACCCACTGTCAGCCAGCCACAAACTTCAAGCAAAGCCAAC
ACAGTGGCCCAAACTCAGGGTAAACTAATTATAACTCATCCTCCACCTAAACCGCCAACAAACATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81683. Forward Primer - name:081683_F_cDNA_AK129341, sequence:GACACCAAAAGGCAGAAACTGT; Reverse Primer - name:081683_N_SP6_cDNA_AK129341, sequence:AATGTTTGTTGGCGGTTTAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8289 same embryo
 EMAGE:8290 same embryo
 EMAGE:8288 same embryo
 EurExpress:euxassay_007711 same experiment
 MGI:4823056 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS