Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8327

Nts neurotensin ( MGI:1328351)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327
"Pseudo-wholemount" of euxassay_007634. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007634_01 euxassay_007634_02 euxassay_007634_03 euxassay_007634_04
EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327
euxassay_007634_05 euxassay_007634_06 euxassay_007634_07 euxassay_007634_08 euxassay_007634_09
EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327
euxassay_007634_10 euxassay_007634_11 euxassay_007634_12 euxassay_007634_13 euxassay_007634_14
EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327 EMAGE:8327
euxassay_007634_15 euxassay_007634_16 euxassay_007634_17 euxassay_007634_18 euxassay_007634_19
EMAGE:8327 EMAGE:8327 EMAGE:8327
euxassay_007634_20 euxassay_007634_21 euxassay_007634_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8327Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8327_wholemount_strong.wlz
8327_wholemount_moderate.wlz
8327_wholemount_weak.wlz
8327_wholemount_possible.wlz
8327_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8327_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
single cellmoderate expression: see section 11 14 15 16
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 14 moderate expression: see section 11 12 13 15
telencephalon mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 08 14 15 17 18 19 20 21 22 moderate expression: see section 16
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
strong strong
spottedstrong expression: see section 07 08 10 11 15 16 17 moderate expression: see section 12
ventral grey horn
strong strong
single cellstrong expression: see section 10 11 12 13 14 15 16
heart ventricle
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 13
upper lip
strong strong
regionalstrong expression: see section 06 07 08 10 11 12 13 14
upper jaw incisor
weak weak
regionalweak expression: see section 07 08 09 11 12 13
upper jaw molar
strong strong
regionalstrong expression: see section 08 12
testis
moderate moderate
regionalmoderate expression: see section 06 07 17 18 weak expression: see section 05
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36711
Entity Detected:Nts, neurotensin ( MGI:1328351)
Sequence:sense strand is shown

>T36711
AGAAGAAGATGTGAGAGCCCTGGAGGCAGATCTATTGACAAACATGCATACATCCAAGATCAGCAAAGCA
AGTCCTCCGTCTTGGAAAATGACCTTGCTAAATGTTTGCAGCCTCATAAATAACGTGAACAGCCCGGCCG
AGGAAGCAGGAGACATGCATGATGACGACCTTGTTGGCAAAAGGAAACTTCCCCTTGTTCTGGATGGTTT
TAGCTTGGAAGCAATGCTGACCATCTTCCAGCTCCAGAAAATCTGCCGCAGCAGGGCCTTTCAACACTGG
GAGATAATCCAGGAAGATATCCTTGATAACGTCAATGATAAAAACGAGAAGGAAGAAGTGATAAAGAGAA
AAATCCCTTATATTCTGAAAAGGCAGCTGTATGAAAATAAACCCAGAAGGCCCTACATTCTCAAGAGGGG
TTCCTACTACTACTGAGAAGCTAATTCTTGACCTGTGATTGTGATTGATTACCTGATATCTAGATATATA
ATTATATGTGTGAATAAATGTGACAGAACTTGATTATTTCATCTTTTCCCACAATTGTGCTTTATTGGAT
GTGATGTTTCTTGCATTCATGTAAATTGGATGCAATGTTTTCAAATAAATGTAGATCTTGAGCATGATGT
GTTCTGTATAATTTTAATAGATAATAATCATAAAATATGTAGAACATTTTGTCAATTTGCAAGATAAGTT
ATGGGTCACATGAACAGTCATGGCATTTAGCACGTTATAGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96304. Forward Primer - name:096304_F_cDNA_Nts, sequence:AGAAGAAGATGTGAGAGCCCTG; Reverse Primer - name:096304_N_SP6_cDNA_Nts, sequence:TCCTATAACGTGCTAAATGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8330 same embryo
 EMAGE:8326 same embryo
 EMAGE:8329 same embryo
 EMAGE:8325 same embryo
 EMAGE:8328 same embryo
 EurExpress:euxassay_007634 same experiment
 MGI:4826822 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS