Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8335

Pcsk6 proprotein convertase subtilisin/kexin type 6 ( MGI:102897)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335
"Pseudo-wholemount" of euxassay_007694. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007694_01 euxassay_007694_02 euxassay_007694_03 euxassay_007694_04
EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335
euxassay_007694_05 euxassay_007694_06 euxassay_007694_07 euxassay_007694_08 euxassay_007694_09
EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335
euxassay_007694_10 euxassay_007694_11 euxassay_007694_12 euxassay_007694_13 euxassay_007694_14
EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335
euxassay_007694_15 euxassay_007694_16 euxassay_007694_17 euxassay_007694_18 euxassay_007694_19
EMAGE:8335 EMAGE:8335 EMAGE:8335 EMAGE:8335
euxassay_007694_20 euxassay_007694_21 euxassay_007694_22 euxassay_007694_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8335Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8335_wholemount_strong.wlz
8335_wholemount_moderate.wlz
8335_wholemount_weak.wlz
8335_wholemount_possible.wlz
8335_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8335_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 17 18 19 20 21 22 23
humerus
strong strong
regionalstrong expression: see section 03 22 23 weak expression: see section 01 02
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 04 17 19
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 04
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05 17 18
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 05 06 17 19 20
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 03
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 03
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 03 04
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04
fibula
strong strong
regionalstrong expression: see section 03
tibia
strong strong
regionalstrong expression: see section 01 02 03
femur
strong strong
regionalstrong expression: see section 04 05 06 22 23
adrenal gland
moderate moderate
regionalmoderate expression: see section 07 08 16 17 weak expression: see section 18
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 14 16 17 moderate expression: see section 04 15
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 04 05 06 08 09 10 11 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 11
ventral grey horn
moderate moderate
single cellmoderate expression: see section 10 11 12 13 14 15
nasal septum
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
tongue muscle
weak weak
regionalweak expression: see section 08 09 11
stomach
moderate moderate
regionalmoderate expression: see section 06 07 08 09
mandible
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 11 13 14 15 16 17 18 19 20 21 moderate expression: see section 12
maxilla
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 11 13 14 15 16 17 18 19 20 21 moderate expression: see section 12
maturing glomerular tuft
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 08 17 18
testis
moderate moderate
regionalmoderate expression: see section 06 07 08 19 20 21
lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 01 12
trachea
strong strong
regionalstrong expression: see section 10 11
axial skeleton
strong strong
regionalstrong expression: see section 06 07 08 14 15 16
vault of skull
strong strong
regionalstrong expression: see section 01 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 10 11 19 20 21 22 23
clavicle
strong strong
regionalstrong expression: see section 06 07 15 16 moderate expression: see section 08 14
sternum
strong strong
regionalstrong expression: see section 08 09 10 11 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36733
Entity Detected:Pcsk6, proprotein convertase subtilisin/kexin type 6 ( MGI:102897)
Sequence:sense strand is shown

>T36733
CCACAAAGTGTGTCGAAGATGTGAGGAGAACTGCCTGAGCTGCGAGGGCTCCAGTAGGAACTGCAGCAGA
TGTAAAGCCGGCTTCACACAGCTGGGAACCTCCTGCATCACCAACCACACGTGCAGCAATGCCGATGAGA
CCTTCTGCGAGATGGTGAAGTCCAATCGGCTCTGCGAACGGAAGCTCTTCATCCAGTTTTGCTGCCGCAC
CTGCCTCCTGGCTGGGTAGGGGCACCAGCTGCCCGCAGAGGGCAGGGTCCTCCTGTCTGCCCGTTTGCCC
ATCTACCTTCCTACAGATGGTCAGCCATAGCCTGTTCCTTGGGGTAGCCCTGCATCTGACAGCTGTATCT
CCCCCAGAGCTGGGTTCTACTGCAGCATCTCTGAGCACCTGAACAGGTGGAGGTGGCCCTTAAGGATATG
TGGCTAAATTGACAAAAATCCCCTTGAACTCTGCTTGCTGGCTGCAGTCTAAAGTTGGACTCAAAACAGG
AACAAAAATGAATTGTGAGACTCATACCTGCAGCTTCGGAGTGGCTTCTGGGACCCTAGTTTACTGAGAC
TTCAAGACCAAAGCAGAAAAAGCGAGATGCCTGGCGTCACATCACGTCCTCCTCCCACATATCTGTGTGG
CCGTGACAAATCTCAGCGAGTCGGCTGGCAGGACCCTATGCTGCCCTCACCTATGATGAAGGGCCTCGCT
TCCTCCCTGTGCATCACTGGCCACCAAACAGCCGGAGGGACAGTTTGATCGGACTGTAAATAAAATGGGT
TTCAGGGCATAAGATGTATGACCACTAGAGAGAGAATCTATGTCTACGCAGTCAGCTCCTTCCGAAACGG
CAGCCCCGGCCTGGACGGCCTAGCACCAAACCGAAATAGGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 80473. Forward Primer - name:080473_F_cDNA_Pace4, sequence:CCACAAAGTGTGTCGAAGATGT; Reverse Primer - name:080473_N_SP6_cDNA_Pace4, sequence:GACCTATTTCGGTTTGGTGCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8337 same embryo
 EMAGE:8338 same embryo
 EMAGE:8336 same embryo
 EurExpress:euxassay_007694 same experiment
 MGI:4827102 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS