Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8369

Tpm1 tropomyosin 1, alpha ( MGI:98809)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369
"Pseudo-wholemount" of euxassay_009503. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009503_01 euxassay_009503_02 euxassay_009503_03 euxassay_009503_04
EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369
euxassay_009503_05 euxassay_009503_06 euxassay_009503_07 euxassay_009503_08 euxassay_009503_09
EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369
euxassay_009503_10 euxassay_009503_11 euxassay_009503_12 euxassay_009503_13 euxassay_009503_14
EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369
euxassay_009503_15 euxassay_009503_16 euxassay_009503_17 euxassay_009503_18 euxassay_009503_19
EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369 EMAGE:8369
euxassay_009503_20 euxassay_009503_21 euxassay_009503_22 euxassay_009503_23 euxassay_009503_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8369Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8369_wholemount_strong.wlz
8369_wholemount_moderate.wlz
8369_wholemount_weak.wlz
8369_wholemount_possible.wlz
8369_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8369_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 14
hand mesenchyme
strong strong
regionalstrong expression: see section 21 22 23 24 moderate expression: see section 01 02
hand skin
strong strong
regionalstrong expression: see section 20 21 22 23 moderate expression: see section 01 02 03
interdigital region between hindlimb digits 1 and 2
strong strong
regionalstrong expression: see section 07 08 09 20 21 22 moderate expression: see section 23 24
interdigital region between hindlimb digits 2 and 3
strong strong
regionalstrong expression: see section 07 08 09 10 20 21 22 moderate expression: see section 23 24
interdigital region between hindlimb digits 3 and 4
strong strong
regionalstrong expression: see section 07 08 09 10 19 20 21 22 moderate expression: see section 23
interdigital region between hindlimb digits 4 and 5
strong strong
regionalstrong expression: see section 07 08 09 10 19 21 22
foot mesenchyme
strong strong
regionalstrong expression: see section 05 23 24 moderate expression: see section 03 04
foot skin
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 19 20 21 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 04 05 19 20
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 16 moderate expression: see section 07 08 09 10 11 17 18 19 weak expression: see section 14 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 16 weak expression: see section 09 17
pons mantle layer
strong strong
regionalstrong expression: see section 08 18 weak expression: see section 07 19
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 moderate expression: see section 07 08 09
ventral grey horn
strong strong
regionalstrong expression: see section 10 14 15 weak expression: see section 11 12 13
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 01 02 03 22 23 24 moderate expression: see section 04 05 06 20 21
nasal septum
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
heart atrium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21
heart ventricle
strong strong
regionalstrong expression: see section 06 09 10 11 12 13 14 moderate expression: see section 07 08 15 16
tongue muscle
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 moderate expression: see section 16
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09
hindgut
strong strong
regionalstrong expression: see section 12 13 14 16
midgut
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19
liver
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 11 12 13 14
metanephros
moderate moderate
regionalmoderate expression: see section 06 08 09 16 17 18 19
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
axial skeleton
strong strong
regionalstrong expression: see section 10 11 12 13 moderate expression: see section 14
tail mesenchyme
moderate moderate
spottedmoderate expression: see section 12 13 14 15 16 17
axial skeleton tail region
moderate moderate
spottedmoderate expression: see section 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36871
Entity Detected:Tpm1, tropomyosin 1, alpha ( MGI:98809)
Sequence:sense strand is shown

>T36871
GAACTGGACAAATACTCCGAGGCTCTCAAAGATGCCCAGGAGAAACTGGAGCTGGCGGAGAAAAAGGCCA
CAGATGCTGAAGCTGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAGGAGTTGGATCGTGC
TCAGGAGCGTCTGGCCACAGCTCTGCAGAAGCTGGAGGAGGCCGAGAAGGCTGCAGATGAGAGTGAGAGA
GGCATGAAAGTCATTGAAAGCCGAGCCCAAAAAGATGAAGAAAAGATGGAGATTCAGGAGATCCAGCTGA
AAGAGGCCAAGCACATTGCTGAAGATGCTGACCGGAAGTATGAAGAGGTGGCCCGTAAGCTGGTCATCAT
CGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGCAAATGTGCCGAGCTTGAAGAA
GAATTGAAAACGGTGACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGTACTCTCAGAAGGAAG
ACAAATATGAAGAGGAGATCAAGGTTCTCTCTGACAAGCTGAAGGAGGCTGAAACTCGGGCTGAGTTTGC
AGAGAGATCAGTAACCAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCCCATGCCAAAGAA
GAAAACCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94944. Forward Primer - name:094944_F_cDNA_Tpm1, sequence:GAACTGGACAAATACTCCGAGG; Reverse Primer - name:094944_N_SP6_cDNA_Tpm1, sequence:AGGTTTTCTTCTTTGGCATGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8370 same embryo
 EMAGE:8371 same embryo
 EMAGE:8374 same embryo
 EMAGE:8372 same embryo
 EMAGE:8373 same embryo
 EurExpress:euxassay_009503 same experiment
 MGI:4828877 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS