Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8371

Tle4 transducin-like enhancer of split 4, homolog of Drosophila E(spl) ( MGI:104633)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371
"Pseudo-wholemount" of euxassay_009500. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009500_01 euxassay_009500_02 euxassay_009500_03 euxassay_009500_04
EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371
euxassay_009500_05 euxassay_009500_06 euxassay_009500_07 euxassay_009500_08 euxassay_009500_09
EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371
euxassay_009500_10 euxassay_009500_11 euxassay_009500_12 euxassay_009500_13 euxassay_009500_14
EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371
euxassay_009500_15 euxassay_009500_16 euxassay_009500_17 euxassay_009500_18 euxassay_009500_19
EMAGE:8371 EMAGE:8371 EMAGE:8371 EMAGE:8371
euxassay_009500_20 euxassay_009500_21 euxassay_009500_22 euxassay_009500_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8371Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8371_wholemount_strong.wlz
8371_wholemount_moderate.wlz
8371_wholemount_weak.wlz
8371_wholemount_possible.wlz
8371_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8371_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon mantle layer
strong strong
regionalstrong expression: see section 09 10 12 13 15 16 moderate expression: see section 02 03 04 05 06 07 08 11 14 17 18 19 20 weak expression: see section 21 22 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 14 16 17 moderate expression: see section 07 08 09 15 18 19 weak expression: see section 10 11 12 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 11 13 15 moderate expression: see section 07 08 16 17 18 19 weak expression: see section 10 12 14
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18 19 weak expression: see section 10 11 12 13 14
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 19 moderate expression: see section 08 09 15 16 17 18 weak expression: see section 10 11 12 13 14
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 06 weak expression: see section 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 16 17 18 moderate expression: see section 03 04 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 17 18 19
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 15 weak expression: see section 13
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 08 16 17
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 14 15 16 17
kidney calyx
moderate moderate
regionalmoderate expression: see section 07 08 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36868
Entity Detected:Tle4, transducin-like enhancer of split 4, homolog of Drosophila E(spl) ( MGI:104633)
Sequence:sense strand is shown

>T36868
GTAAGCACTGGAAAGGACAACCTTCTGAATGCTTGGAGGACGCCTTATGGGGCCAGCATATTCCAGTCCA
AAGAATCCTCATCGGTGCTTAGCTGTGACATCTCTGTGGATGACAAGTACATTGTCACTGGCTCTGGGGA
CAAGAAAGCTACGGTTTATGAAGTTATTTATTAAGGACAAATCTTCGTGCAAACTGGACTCCTCCTCATA
GCACTTTGCGCTGTTGTACTTTTCTGTTCACCCCTCTCCCATTCTAAAACCAAGGATTTCCAATACTCAT
TGCAGTTGTGGAGTTTAATCCCTTCCCATAGCCCCACTTCCTCCTTGCTATTGAATTGTGAATACTCATT
AAGAACCTGTGATACCAAATCTTCAGCTATCGTCTTGGAAGAACATGGAATACCTAACAGTGAATGGAAT
CTTTAATTATGTATTATATCTGTAATATATTTATTTTGTTTAAAGAAGGCTTTCTAACAATGACTGACTA
AATAAAGCTGTCCGCTCCTGCATTGATAATGAAGGTGCATTGTATTTGATGCTCCACCCCTCCCTTTTGG
TGAGGGAGGGGAAAGGAAGGTTTAAAATAACTGATTTAAATGTCACTAAATGTAGACTATTGACTGTATA
GAGATGTGAAATGTATAATTACACACGGAAGCAATATGTTGCTGTGTTGTTATGAGGTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95729. Forward Primer - name:095729_F_cDNA_Tle4, sequence:GTAAGCACTGGAAAGGACAACC; Reverse Primer - name:095729_N_SP6_cDNA_Tle4, sequence:CAACCTCATAACAACACAGCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8370 same embryo
 EMAGE:8374 same embryo
 EMAGE:8372 same embryo
 EMAGE:8369 same embryo
 EMAGE:8373 same embryo
 EurExpress:euxassay_009500 same experiment
 MGI:4828735 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS