Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8373

Trp73 transformation related protein 73 ( MGI:1336991)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373
"Pseudo-wholemount" of euxassay_009505. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009505_01 euxassay_009505_02 euxassay_009505_03 euxassay_009505_04
EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373
euxassay_009505_05 euxassay_009505_06 euxassay_009505_07 euxassay_009505_08 euxassay_009505_09
EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373
euxassay_009505_10 euxassay_009505_11 euxassay_009505_12 euxassay_009505_13 euxassay_009505_14
EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373
euxassay_009505_15 euxassay_009505_16 euxassay_009505_17 euxassay_009505_18 euxassay_009505_19
EMAGE:8373 EMAGE:8373 EMAGE:8373 EMAGE:8373
euxassay_009505_20 euxassay_009505_21 euxassay_009505_22 euxassay_009505_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8373Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8373_wholemount_strong.wlz
8373_wholemount_moderate.wlz
8373_wholemount_weak.wlz
8373_wholemount_possible.wlz
8373_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8373_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 09 10 16 17 18 19 20
vibrissa
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 16 17 18 19 20 21 23
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 14 15 16
choroid invagination
moderate moderate
regionalmoderate expression: see section 05 06 07 14 15 16 17 18 19
telencephalon mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19 weak expression: see section 12
telencephalon marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 12
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 03 04 05 06 09 10 16 17 18 19 20 21
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 moderate expression: see section 13
vomeronasal organ
strong strong
regionalstrong expression: see section 10 moderate expression: see section 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 10 14 weak expression: see section 12 13
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 16 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 14 weak expression: see section 13
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36872
Entity Detected:Trp73, transformation related protein 73 ( MGI:1336991)
Sequence:sense strand is shown

>T36872
CCTTTGGTTGACTCCTATCGACAGCAGCAGCAGCAGCAGCTCCTACAGAGGCCGAGTCACCTGCAGCCTC
CATCCTATGGGCCCGTGCTCTCCCCAATGAACAAGGTACACGGTGGTGTCAACAAACTGCCCTCCGTCAA
CCAGCTGGTGGGCCAGCCTCCCCCGCACAGCTCAGCAGCTGGGCCCAACCTGGGGCCCATGGGCTCCGGG
ATGCTCAACAGCCACGGCCACAGCATGCCGGCCAATGGTGAGATGAATGGAGGCCACAGCTCCCAGACCA
TGGTTTCGGGATCCCACTGCACCCCGCCACCCCCCTATCATGCAGACCCCAGCCTCGTCAGTTTTTTGAC
AGGGTTGGGGTGTCCAAACTGCATCGAGTGCTTCACTTCCCAAGGGTTGCAGAGCATCTACCACCTGCAG
AACCTTACCATCGAGGACCTTGGGGCTCTGAAGGTCCCTGACCAGTACCGTATGACCATCTGGAGGGGCC
TACAGGACCTGAAGCAGAGCCATGACTGCGGCCAGCAACTGCTACGCTCCAGCAGCAACGCGGCCACCAT
CTCCATCGGCGGCTCTGGCGAGCTGCAGCGGCAGCGGGTCATGGAAGCCGTGCATTTCCGTGTGCGCCAC
ACCATCACAATCCCCAACCGTGGAGGCGCAGGTGCGGTGACAGGTCCCGACGAGTGGGCGGACTTTGGCT
TTGACCTGCCTGACTGCAAGTCCCGTAAGCAGCCCATCAAAGAGGAGTTCACAGAGACAGAGAGCCACTG
AGGAACGTAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90471. Forward Primer - name:090471_F_cDNA_Trp73, sequence:CCTTTGGTTGACTCCTATCGAC; Reverse Primer - name:090471_N_SP6_cDNA_Trp73, sequence:GTACGTTCCTCAGTGGCTCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8370 same embryo
 EMAGE:8371 same embryo
 EMAGE:8374 same embryo
 EMAGE:8372 same embryo
 EMAGE:8369 same embryo
 EurExpress:euxassay_009505 same experiment
 MGI:4828936 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS