Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8382

Txk TXK tyrosine kinase ( MGI:102960)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382
"Pseudo-wholemount" of euxassay_009507. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009507_01 euxassay_009507_02 euxassay_009507_03 euxassay_009507_04
EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382
euxassay_009507_05 euxassay_009507_06 euxassay_009507_07 euxassay_009507_08 euxassay_009507_09
EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382
euxassay_009507_10 euxassay_009507_11 euxassay_009507_12 euxassay_009507_13 euxassay_009507_14
EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382
euxassay_009507_15 euxassay_009507_16 euxassay_009507_17 euxassay_009507_18 euxassay_009507_19
EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382 EMAGE:8382
euxassay_009507_20 euxassay_009507_21 euxassay_009507_22 euxassay_009507_23 euxassay_009507_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8382Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8382_wholemount_strong.wlz
8382_wholemount_moderate.wlz
8382_wholemount_weak.wlz
8382_wholemount_possible.wlz
8382_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8382_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
spottedmoderate expression: see section 01 05 06 07 08 09 10 16 17 18 19 20 21 22 23 24 weak expression: see section 02 03 04 11 12 13 14 15
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 01 05 06 07 08 09 16 17 18 19 20 21 22 23 24 weak expression: see section 02 03 04 11 12 13 14 15
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13 14
stomach mesentery
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09
bladder
weak weak
spottedweak expression: see section 12 13 14
left lung
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
right lung
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21 22
extraembryonic component
moderate moderate
spottedmoderate expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36874
Entity Detected:Txk, TXK tyrosine kinase ( MGI:102960)
Sequence:sense strand is shown

>T36874
CCTTTTCAGATAGCTCCTTCCAGTCTGTTCTCTGCTGCTGCTGTTGCCGCTGCTCAGTACAGAAGAGACA
GGTGAGAACTCAGATAAGCCTGAGCAGAGAGGAAGAACTCTCAGAAAAACATTCCCAGCGTCAGAGGCCG
TGGTTCGCCAAACTGATGGGCAAAACTCAATCCAACAGAGGCGGGGTGCAACCCTCGAAGCGCAAGCCGC
TGCCTCCCCTCCCGCAGGAGCCTCCAGATGAGAGAATCCAGGTCAAGGCTCTTTATGACTTCCTGCCTCG
GGAGCCTGGTAATTTGGCACTGAAGAGAGCGGAGGAATATCTGATATTGGAGAGGTGTGATCCTCACTGG
TGGAAGGCCAGAGACCGCTTCGGGAATGAAGGCTTAATCCCAAGCAACTATGTGACAGAAAACAGACTCG
CCAACTTAGAAATCTATGAATGGTACCACAAGAACATTACGAGAAACCAGACCGAACGCCTATTGAGGCA
AGAGGCTAAAGAAGGTGCCTTTATCGTGAGAGATTCGAGACACTTGGGGTCTTACACAATCTCTGTGTTT
ACAAGAGCTCGAAGGCATACACAGTCTTCAATAAAACATTATCAGATAAAAAAGAATGACTCCGGACAGT
GGTACATCACCGAAAGACATCTCTTCCCCTCAGTCCCCGAGTTGATCCAGTATCACCAGTACAATGCAGC
TGGTCTCATATCTCGTCTCCGCTATCCCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74737. Forward Primer - name:074737_F_cDNA_Txk, sequence:CCTTTTCAGATAGCTCCTTCCA; Reverse Primer - name:074737_N_SP6_cDNA_Txk, sequence:ATGGGATAGCGGAGACGAGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8386 same embryo
 EMAGE:8381 same embryo
 EMAGE:8384 same embryo
 EMAGE:8383 same embryo
 EMAGE:8385 same embryo
 EurExpress:euxassay_009507 same experiment
 MGI:4829029 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS