Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8384

Zbtb16 zinc finger and BTB domain containing 16 ( MGI:103222)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384
"Pseudo-wholemount" of euxassay_009508. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009508_01 euxassay_009508_02 euxassay_009508_03 euxassay_009508_04
EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384
euxassay_009508_05 euxassay_009508_06 euxassay_009508_07 euxassay_009508_08 euxassay_009508_09
EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384
euxassay_009508_10 euxassay_009508_11 euxassay_009508_12 euxassay_009508_13 euxassay_009508_14
EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384
euxassay_009508_15 euxassay_009508_16 euxassay_009508_17 euxassay_009508_18 euxassay_009508_19
EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384 EMAGE:8384
euxassay_009508_20 euxassay_009508_21 euxassay_009508_22 euxassay_009508_23 euxassay_009508_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8384Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8384_wholemount_strong.wlz
8384_wholemount_moderate.wlz
8384_wholemount_weak.wlz
8384_wholemount_possible.wlz
8384_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8384_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
regionalmoderate expression: see section 09 10 17 18 19 20
thymus primordium
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13
brain
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 weak expression: see section 02 03 04 05 06 20 21 22 23 24
trigeminal v nerve
strong strong
regionalstrong expression: see section 07 08 16 moderate expression: see section 09 15
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 08 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36876
Entity Detected:Zbtb16, zinc finger and BTB domain containing 16 ( MGI:103222)
Sequence:sense strand is shown

>T36876
GTCACTCCTGCAAGGAACTCTTCAGCCACCTGCAGGGCCTGAGGAGCCCACACTGGCAGGGGGTGGGCGA
CACCCTGGGGTGGCTGAGGTGAAGATGGAAATGATGCAGGTAGATGAAGCCCCTGGCCAGGACAGCCCTG
GGGCAGCTGAGTCTAGCATCTCAGGAGGGATGGGGGACAAGCTTGAAGAGAGGAGCAAAGAGGGGCCTGG
GACCCCGACTCGAGGCAGTGTCATCACTAGTGCCAGAGAGCTGCATTATGGGAGAGAGGAGAGTGGTGAG
CAGCTCTCGCCTCCTGTTGAAGCTGGCCAGGGACCCCCTGGGCGGCAGGAGCCCCTGGCACCCCCAGTGG
AGAAGCATTTGGGTATCTACTCGGTGCTGCCCAACCACAAGGCCGATGCTGTGTTGAGCATGCCGTCTTC
AGTGACGTCCGGTCTCCATGTGCAACCTGCCCTGGCAGTCTCCATGGACTTCAGCACCTACGGGGGTCTG
CTGCCTCAGGGCTTCATCCAGAGGGAGCTGTTCAGCAAGCTGGGGGAGCTGGCTGTGGGCATGAAGGCTG
AGAGCCGCCCTCTGGGGGAGCAGTGCAGCGTGTGTGGGGTCGAGCTTCCGGACAACGAGGCAGTGGAGCA
GCACAGGAAACTGCACAGTGGGATGAAAACATACGGGTGTGAACTCTGCGGAAAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81873. Forward Primer - name:081873_F_cDNA_Zbtb16, sequence:GTCACTCCTGCAAGGAACTCTT; Reverse Primer - name:081873_N_SP6_cDNA_Zbtb16, sequence:GTTTTCCGCAGAGTTCACACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8386 same embryo
 EMAGE:8381 same embryo
 EMAGE:8382 same embryo
 EMAGE:8383 same embryo
 EMAGE:8385 same embryo
 EurExpress:euxassay_009508 same experiment
 MGI:4829261 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS