Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8402

Rab11fip4 RAB11 family interacting protein 4 (class II) ( MGI:2442920)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402
"Pseudo-wholemount" of euxassay_009634. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009634_01 euxassay_009634_02 euxassay_009634_03 euxassay_009634_04
EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402
euxassay_009634_05 euxassay_009634_06 euxassay_009634_07 euxassay_009634_08 euxassay_009634_09
EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402
euxassay_009634_10 euxassay_009634_11 euxassay_009634_12 euxassay_009634_13 euxassay_009634_14
EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402
euxassay_009634_15 euxassay_009634_16 euxassay_009634_17 euxassay_009634_18 euxassay_009634_19
EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402 EMAGE:8402
euxassay_009634_20 euxassay_009634_21 euxassay_009634_22 euxassay_009634_23 euxassay_009634_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8402Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8402_wholemount_strong.wlz
8402_wholemount_moderate.wlz
8402_wholemount_weak.wlz
8402_wholemount_possible.wlz
8402_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8402_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24
radius
weak weak
regionalweak expression: see section 01
humerus
moderate moderate
regionalmoderate expression: see section 04 05 21 22 23 weak expression: see section 02 03
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 02
tarsus
moderate moderate
regionalmoderate expression: see section 03
hip
moderate moderate
regionalmoderate expression: see section 10 17
fibula
moderate moderate
regionalmoderate expression: see section 02
tibia
moderate moderate
regionalmoderate expression: see section 01 02
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 07 19 20 24 weak expression: see section 06 21 22 23
thymus primordium
strong strong
regionalstrong expression: see section 11 12 15 moderate expression: see section 13 14
forebrain
moderate moderate
regionalmoderate expression: see section 01 05 06 09 10 11 12 13 14 15 17 18 19 20 24 weak expression: see section 02 03 04 07 08 16 21 22 23
hindbrain
moderate moderate
regionalmoderate expression: see section 05 06 09 10 11 12 13 14 15 17 18 19 20 weak expression: see section 03 04 07 08 16
midbrain
moderate moderate
regionalmoderate expression: see section 05 06 09 10 11 12 13 14 15 17 18 weak expression: see section 07 08 16
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 19 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 08 17
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 11 15 16 17
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18
neural retina
weak weak
regionalweak expression: see section 02 03 23 24
nasal septum
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 11 12
mandible
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 15 16 17 18 19 20 21
meckel's cartilage
strong strong
regionalstrong expression: see section 13 14 weak expression: see section 06 07 08 09 10 12 15 16 17 18 19 20
cricoid cartilage
weak weak
regionalweak expression: see section 10 15
thyroid cartilage
weak weak
regionalweak expression: see section 11 12 13 14
axial skeleton
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18
basisphenoid bone
strong strong
regionalstrong expression: see section 14 moderate expression: see section 01 02 12 13 23 24
exoccipital bone
strong strong
regionalstrong expression: see section 05 moderate expression: see section 01 02 03 04 18 19 20 21 23 24
temporal bone petrous part
strong strong
regionalstrong expression: see section 05 moderate expression: see section 01 02 03 04 19 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 06 07 08 18 19 20 moderate expression: see section 01 02 03 04 12 21 22 23 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 09 10 16 weak expression: see section 07 08 17 18
scapula
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 03 05 21 22 23
axial skeleton tail region
weak weak
regionalweak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36932
Entity Detected:Rab11fip4, RAB11 family interacting protein 4 (class II) ( MGI:2442920)
Sequence:sense strand is shown

>T36932
AGGACGAGATGGACCTTTACAAGCGCATGATGGACAAGCTGCGGCAGAACCGCCTGGAGTTCCAGAAGGA
GCGGGAGGCGACGCAGGAGCTCATCGAGGACTTGCGGAGAGAGCTGGAGCACCTGCAGATGTACAAGCTG
GACTGCGAGCGGCCAGGTAGGGGCCGCAGCTCCTCTGGCCTTGGCGAGTTCAACGCCAGAGCCCGGGAGG
TGGAACTTGAACATGAGGTCAAGCGTCTGAAGCAGGAGAATCACAAGCTGCGGGATCAGAATGATGATTT
AAATGGGCAGATCCTGAGCCTCAGCCTCTACGAGGCGAAGAACCTCTTTGCAACCCAGACCAAAGCCCAG
TCTCTGGCTGCAGAAATCGACACAGCATCTCGAGATGAGCTAATGGAGGCCCTGAAGGAGCAGGAGGAGA
TCAACTTCCGACTGAGACAGTACATGGACAAGATTATCCTGGCTATACTGGACCACAACCCCTCCATCTT
GGAGATTAAACACTGAGTCAGGGTTGGCTGCAGAGCGGCCGTCGGACCTGGGACCTAAGGGCAGGCCTGC
CTGAGGACGAAGAAAGATGCAGGCTTTGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88806. Forward Primer - name:088806_F_cDNA_Rab11fip4, sequence:AGGACGAGATGGACCTTTACAA; Reverse Primer - name:088806_N_SP6_cDNA_Rab11fip4, sequence:GGCAAAGCCTGCATCTTTCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8400 same embryo
 EMAGE:8403 same embryo
 EMAGE:8399 same embryo
 EMAGE:8404 same embryo
 EMAGE:8401 same embryo
 EurExpress:euxassay_009634 same experiment
 MGI:4827564 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS