Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8422

Ptprn protein tyrosine phosphatase, receptor type, N ( MGI:102765)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422
"Pseudo-wholemount" of euxassay_009628. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009628_01 euxassay_009628_02 euxassay_009628_03 euxassay_009628_04
EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422
euxassay_009628_05 euxassay_009628_06 euxassay_009628_07 euxassay_009628_08 euxassay_009628_09
EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422
euxassay_009628_10 euxassay_009628_11 euxassay_009628_12 euxassay_009628_13 euxassay_009628_14
EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422 EMAGE:8422
euxassay_009628_15 euxassay_009628_16 euxassay_009628_17 euxassay_009628_18 euxassay_009628_19
EMAGE:8422 EMAGE:8422 EMAGE:8422
euxassay_009628_20 euxassay_009628_21 euxassay_009628_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8422Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8422_wholemount_strong.wlz
8422_wholemount_moderate.wlz
8422_wholemount_weak.wlz
8422_wholemount_possible.wlz
8422_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8422_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 21 weak expression: see section 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 21 22 weak expression: see section 19 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 13 14 15 weak expression: see section 11 12
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 15 weak expression: see section 09
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 13
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36924
Entity Detected:Ptprn, protein tyrosine phosphatase, receptor type, N ( MGI:102765)
Sequence:sense strand is shown

>T36924
CCCATGGTGACACTACTTTTGAGTACCAGGACCTGTGTCGCCAGCACATGGCCACAAAGTCCCTGTTTAA
CCGGGCGGAGGGTCAGCCAGAGCCTTCTAGGGTGAGCAGTGTGTCCTCCCAGTTCAGCGACGCGGCCCAG
GCCAGCCCCAGTTCCCACAGCAGCACACCATCTTGGTGCGAGGAGCCCGCCCAGGCCAACATGGACATCT
CCACAGGACACATGATTCTGGCATACATGGAGGATCACCTTCGGAACCGGGACCGGTTGGCCAAGGAGTG
GCAGGCTCTGTGCGCCTACCAAGCAGAGCCAAACACCTGTGCCGCCGCACAGGATGAGAGCAACATCAAG
AAGAACCGCCATCCTGACTTCCTACCCTATGACCATGCCCGAATCAAGCTGAAAGTGGAGAGCAGCCCTT
CTCGGAGTGATTACATCAACGCCAGCCCCATCATCGAGCATGACCCTCGGATGCCGGCCTACATAGCCAC
ACAGGGACCACTGTCCCACACCATCGCGGACTTCTGGCAGATGGTGTGGGAGAGTGGCTGCACTGTCATC
GTTATGCTGACCCCGTTGGTGGAGGACGGTGTCAAACAGTGTGACCGCTACTGGCCGGATGAAGGATCTT
CCCTCTACCACGTCTATGAGGTGAACCTGGTGTCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98419. Forward Primer - name:098419_F_cDNA_Ptprn, sequence:CCCATGGTGACACTACTTTTGA; Reverse Primer - name:098419_N_SP6_cDNA_Ptprn, sequence:CGACACCAGGTTCACCTCATA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8419 same embryo
 EMAGE:8418 same embryo
 EMAGE:8421 same embryo
 EMAGE:8417 same embryo
 EMAGE:8420 same embryo
 EurExpress:euxassay_009628 same experiment
 MGI:4827530 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS