Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8428

Nptx1 neuronal pentraxin 1 ( MGI:107811)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428
"Pseudo-wholemount" of euxassay_009619. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009619_01 euxassay_009619_02 euxassay_009619_03 euxassay_009619_04
EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428
euxassay_009619_05 euxassay_009619_06 euxassay_009619_07 euxassay_009619_08 euxassay_009619_09
EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428
euxassay_009619_10 euxassay_009619_11 euxassay_009619_12 euxassay_009619_13 euxassay_009619_14
EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428
euxassay_009619_15 euxassay_009619_16 euxassay_009619_17 euxassay_009619_18 euxassay_009619_19
EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428 EMAGE:8428
euxassay_009619_20 euxassay_009619_21 euxassay_009619_22 euxassay_009619_23 euxassay_009619_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8428Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8428_wholemount_strong.wlz
8428_wholemount_moderate.wlz
8428_wholemount_weak.wlz
8428_wholemount_possible.wlz
8428_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8428_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 13 14 weak expression: see section 11 12
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14 15 weak expression: see section 11 12
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 09 10 14 15 16 17 18 19 20 weak expression: see section 06 07 08 11 13 21
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 16 17 weak expression: see section 14
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 15 16 weak expression: see section 10 11 13 14
rest of cerebellum mantle layer
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 15 16 17 18 weak expression: see section 19
pons mantle layer
moderate moderate
single cellmoderate expression: see section 07 09 10 14 15
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 05 18 19 weak expression: see section 06 07 16 17
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
ventral grey horn
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 08 09 10 12 13 14 15 16 17 18
lower jaw molar
strong strong
regionalstrong expression: see section 07 18 19
upper jaw molar
strong strong
regionalstrong expression: see section 07 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36699
Entity Detected:Nptx1, neuronal pentraxin 1 ( MGI:107811)
Sequence:sense strand is shown

>T36699
GTGCACATGTGTCTGTTGAATGCTGAGGAGGCTGTGTCCAGGCAGGGTGGACCCCTCGATTGTTCCCCCC
CGTGTTGTGGGCACACACCCAGTGACACCTGGACTATGTCTCCAGTAGCCTGACTAGCAGGAGGCTGGCA
AGTCTTTCTAGAAACCTACGCACTGCCTGGCTCGTCTGCAGCTGCAGACAACTTAATTCCTCAACAGGAG
CAGGTTTTCCACCTGCTGTTCTTCCAGGGGCACCTGTCTCCTTCCACACAGGTCCATGTTGTGTCTGAAA
CTAGTGCATCCGTGTCTGTCTGTGTGCTGTCTGTGTCACTGTTCTTGTGGGTGTCTGCACAGTTCCCTGG
TCACTGCTCTGTGGTGCATCCTCTCTGAGGGTGCGGATCAGGCTGTGCTCCACCCGTTGTCCAGCAGTGG
ACTTTTTCTTAGAATAATTGTGCTTCCTCAGGACAGCACGCCGGGTTGTGGCATCCTTGGATCTGCGGGG
ATCTTCTGTGTTTGCATGTTCCTCAGGGTGGTGTGTCCCTTGCTCCCTTGGTCTGAGCGCGTGTTCCCTT
GCCTGCATGGACTTCTCTGGTTCTGTGTTTGTGTGCTGAATGCCACCCAGTGTTCTGTGATCACCCATGT
AGCTACTGAAAAATGGCTGGGTAAGCAAGCCAGGGGTGTTGGGGAGGTCAGGAGAGAGATCAACATGCCT
CTCCCCTCCCCCTCCCCAGACATAGCAAGAAGCATTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 73937. Forward Primer - name:073937_F_cDNA_Nptx1, sequence:GTGCACATGTGTCTGTTGAATG; Reverse Primer - name:073937_N_SP6_cDNA_Nptx1, sequence:GAAATGCTTCTTGCTATGTCTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8430 same embryo
 EMAGE:8431 same embryo
 EMAGE:8432 same embryo
 EMAGE:8433 same embryo
 EMAGE:8429 same embryo
 EurExpress:euxassay_009619 same experiment
 MGI:4826773 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS