Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8431

Nog noggin ( MGI:104327)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431
"Pseudo-wholemount" of euxassay_009618. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009618_01 euxassay_009618_02 euxassay_009618_03 euxassay_009618_04
EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431
euxassay_009618_05 euxassay_009618_06 euxassay_009618_07 euxassay_009618_08 euxassay_009618_09
EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431
euxassay_009618_10 euxassay_009618_11 euxassay_009618_12 euxassay_009618_13 euxassay_009618_14
EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431 EMAGE:8431
euxassay_009618_15 euxassay_009618_16 euxassay_009618_17 euxassay_009618_18 euxassay_009618_19
EMAGE:8431
euxassay_009618_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8431Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8431_wholemount_strong.wlz
8431_wholemount_moderate.wlz
8431_wholemount_weak.wlz
8431_wholemount_possible.wlz
8431_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8431_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20 weak expression: see section 01 02 03 04 05 06 07 14 15
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 02 20
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 04 05 20
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 03 04 05
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 03 04 05
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 04 05 11 12
pons mantle layer
weak weak
regionalweak expression: see section 03 13
ventral grey horn
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06 07 08 09 11
otic capsule
weak weak
regionalweak expression: see section 03 04 05 12 13 14 15
nasal septum
weak weak
regionalweak expression: see section 08 09 10 11
viscerocranium
weak weak
regionalExpression in the turbinate bone.
mandible
weak weak
regionalweak expression: see section 01 02 03 04 05 13 14 15 16 17
thyroid cartilage
weak weak
regionalweak expression: see section 07 08 09 10
axial skeleton
weak weak
regionalweak expression: see section 04 05 06 07 08 09 14
sternum
strong strong
regionalstrong expression: see section 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36692
Entity Detected:Nog, noggin ( MGI:104327)
Sequence:sense strand is shown

>T36692
TCGAACATCCAGACCCTATCTTTGACCCTAAGGAGAAGGATCTGAACGAGACGCTGCTGCGCTCGCTGCT
CGGGGGCCACTACGACCCGGGCTTTATGGCCACTTCGCCCCCAGAGGACCGACCCGGAGGGGGCGGGGGA
CCGGCTGGAGGTGCCGAGGACCTGGCGGAGCTGGACCAGCTGCTGCGGCAGCGGCCGTCGGGGGCCATGC
CGAGCGAGATCAAAGGGCTGGAGTTCTCCGAGGGCTTGGCCCAAGGCAAGAAACAGCGCCTGAGCAAGAA
GCTGAGGAGGAAGTTACAGATGTGGCTGTGGTCACAGACCTTCTGCCCGGTGCTGTACGCGTGGAATGAC
CTAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98219. Forward Primer - name:098219_F_cDNA_Nog, sequence:TCGAACATCCAGACCCTATCTT; Reverse Primer - name:098219_N_SP6_cDNA_Nog, sequence:CTAGGTCATTCCACGCGTACAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8430 same embryo
 EMAGE:8428 same embryo
 EMAGE:8432 same embryo
 EMAGE:8433 same embryo
 EMAGE:8429 same embryo
 EurExpress:euxassay_009618 same experiment
 MGI:4826743 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS