Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:848

Igf2 insulin-like growth factor 2 ( MGI:96434)
TS12 (8.0 dpc)
in situ hybridisation

Data Images
EMAGE:848
Fig 2E Lee et al, 1990 [PMID:1964408] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image annotations: h, heart; fg, foregut; bi, blood island; ec, ectoplacental cone; ve, visceral primitive endoderm; pe, parietal primitive endoderm; em, extraembryonic mesoderm; vys, visceral yolk sac.
Expression Pattern Description
Spatial Annotation:
EMAGE:848EMAGE:848Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
848_voxel_strong_3D_1.wlz
848_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:848_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
ectoplacental cone
weak weak
heart
strong strong
yolk sac endoderm
not detected not detected
blood island
not detected not detected
extraembryonic component
detected detected
regionalExtraembryonic mesoderm continued to exhibit a positive signal
foregut diverticulum endoderm
strong strong
regionalThe hybridization signal was localized in the ventral and lateral walls, whereas the dorsal wall was practically unlabeled at this stage.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1344322
Entity Detected:Igf2, insulin-like growth factor 2 ( MGI:96434)
Sequence:sense strand is shown

>MGI:1344322
GGATCCCAGTGGGGAAGTCGATGTTGGTGCTTCTCATCTCTTTGGCCTTCGCCTTGTGCTGCATCGCTGC
TTACCGCCCCAGCGAGACTCTGTGCGGAGGGGAGCTTGTTGACACGCTTCAGTTTGTCTGTTCGGACCGC
GGCTTCTACTTCAGCAGGCCTTCAAGCCGTGCCAACCGTCGCAGCCGTGGCATCGTGGAAGAGTGCTGCT
TCCGCAGCTGCGACTTGGCCCTCCTGGAGACATACTGTGCCACCCCCGCCAAGTCCGAGAGGGACGTGTC
TACCTCTCAGGCCGTACTTCCGGACGACTTCCCCAGATACCCCGTGGGCAAGTTCTTCAAATTCGACACC
TGGAGACAGTCCGCGGGACGCCTGCGCAGAGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGCATGC
TTGCCAAAGAGCTCGAAGCGTTCAGAGAGGCCAAGCGCCACCGTCCCCTGATCGTGTTACCACCCAAAGA
CCCCGCCCACGGGGGAGCCTCTTCGGAGATGTCCAGCAACCATCAGTGAACCAAAT
nt 1136 - nt 1681 of NM_031511.1
Notes:The Igf2 probe used in this study by Lee et al, 1990 [PMID:1964408] is denoted as the rat probe used by Stylianopoulou et al, 1988 [PMID:3246220] . The authors note that the rat and mouse sequences differ over this region by 10 out of 545 nt. Stylianopoulou et al in turn define the probe as "a 545-bp fragment from the rat IGF-II cDNA clone 27 (Soares et al, 1986 [PMID:2438416] ). This fragment extends between a BamHI site, located one nucleotide downstream from the ATG initiator, and an EcoRI linker present at the end of the fragment, three nucleotides downstream from the TGA terminator".
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:8.0 dpc
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:section
Procedures
Staining procedure:autoradiography
General Information
Authors:Lee et al, 1990 [PMID:1964408] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:1964408] Lee JE, Pintar J, Efstratiadis A 1990 Pattern of the insulin-like growth factor II gene expression during early mouse embryogenesis. Development (110):151-9
 [ doi:10.1016/0022-2836(86)90025-2] [ PMID:2438416] Soares MB, Turken A, Ishii D, Mills L, Episkopou V, Cotter S, Zeitlin S, Efstratiadis A 1986 Rat insulin-like growth factor II gene. A single gene with two promoters expressing a multitranscript family. J Mol Biol (192):737-52
 [ PMID:3246220] Stylianopoulou F, Efstratiadis A, Herbert J, Pintar J 1988 Pattern of the insulin-like growth factor II gene expression during rat embryogenesis. Development (103):497-506
Links:MGI:1344456 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI