Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8494

Ptpn4 protein tyrosine phosphatase, non-receptor type 4 ( MGI:1099792)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494
"Pseudo-wholemount" of euxassay_009725. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009725_01 euxassay_009725_02 euxassay_009725_03 euxassay_009725_04
EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494
euxassay_009725_05 euxassay_009725_06 euxassay_009725_07 euxassay_009725_08 euxassay_009725_09
EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494
euxassay_009725_10 euxassay_009725_11 euxassay_009725_12 euxassay_009725_13 euxassay_009725_14
EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494
euxassay_009725_15 euxassay_009725_16 euxassay_009725_17 euxassay_009725_18 euxassay_009725_19
EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494 EMAGE:8494
euxassay_009725_20 euxassay_009725_21 euxassay_009725_22 euxassay_009725_23 euxassay_009725_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8494Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8494_wholemount_strong.wlz
8494_wholemount_moderate.wlz
8494_wholemount_weak.wlz
8494_wholemount_possible.wlz
8494_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8494_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14
pons ventricular layer
weak weak
regionalweak expression: see section 06 07 08 15 16
spinal cord ventricular layer
weak weak
regionalweak expression: see section 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36920
Entity Detected:Ptpn4, protein tyrosine phosphatase, non-receptor type 4 ( MGI:1099792)
Sequence:sense strand is shown

>T36920
TCAGAGATCTCCATCATCAACGCAAGCTAATAGCATAGTTCTGGAGTCATCACCATCACAAGAGACCCCT
GAAGATGGGCAGCCACCAGCTTTACCACCCAAACAATCTAAGAAAAATAGTTGGAACCAAATTCATTTTT
CAAACTCTCAGCAAGATCTAGTCACCCATACTAATGAATCCTTTGATGTGCCCTCTTCCCCTGAAAAGTC
CACTCCTAATGGTGGCATTCCACATGATAACCTTGTTCTAATCAAAATGAAACCTGATGAAAATGGAAGG
TTTGGATTCAATGTAAAGGGAGGATATGATCAGAAGATGCCTGTAATTGTTTCTCGAGTAGCACCAGGAA
CACCTGCTGACCTCTGTGTCCCTCGCTTGAATGAAGGGGACCAAGTGGTACTAATAAATGGTCGGGACAT
TGCAGAACATACCCATGATCAAGTAGTCTTGTTTATTAAAGCTAGCTGTGAGAAACATTCTGGGGAACTC
GTGCTCCTAGTCCGACCTAATGCTGTATATGATGTAGTGGAAGAAAAACTAGAAAGTGAACCAGACTTCC
AGTATATTCCTGAGAAAGCCCCACTAGATAGTGTCCATCAAGATGACCATTCCTTGCGGGAGTCAATGAT
CCAGCTAGCTGAGGGGCTTATCACTGGAACAGTACTGGCACAGTTTGATCAACTCTATCGGAAAAAACCT
GGAATGACAATGTCTTGTGCCAAATTACCTCAGAACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100594. Forward Primer - name:100594_F_cDNA_Ptpn4, sequence:TCAGAGATCTCCATCATCAACG; Reverse Primer - name:100594_N_SP6_cDNA_Ptpn4, sequence:TGTTCTGAGGTAATTTGGCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8495 same embryo
 EMAGE:8497 same embryo
 EMAGE:8496 same embryo
 EMAGE:8493 same embryo
 EMAGE:8492 same embryo
 EurExpress:euxassay_009725 same experiment
 MGI:4827520 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS