Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8497

Prkce protein kinase C, epsilon ( MGI:97599)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497
"Pseudo-wholemount" of euxassay_009722. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009722_01 euxassay_009722_02 euxassay_009722_03 euxassay_009722_04
EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497
euxassay_009722_05 euxassay_009722_06 euxassay_009722_07 euxassay_009722_08 euxassay_009722_09
EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497
euxassay_009722_10 euxassay_009722_11 euxassay_009722_12 euxassay_009722_13 euxassay_009722_14
EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497
euxassay_009722_15 euxassay_009722_16 euxassay_009722_17 euxassay_009722_18 euxassay_009722_19
EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497 EMAGE:8497
euxassay_009722_20 euxassay_009722_21 euxassay_009722_22 euxassay_009722_23 euxassay_009722_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8497Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8497_wholemount_strong.wlz
8497_wholemount_moderate.wlz
8497_wholemount_weak.wlz
8497_wholemount_possible.wlz
8497_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8497_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon mantle layer
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 02 03 04 05 06 07 11 15 20 21 22 23
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 10 11 12 15 16 17 18
hindbrain
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 18 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 07 16
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 11 12 13 14 15 16 17
neural retina
weak weak
regionalweak expression: see section 01 02 03 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36896
Entity Detected:Prkce, protein kinase C, epsilon ( MGI:97599)
Sequence:sense strand is shown

>T36896
ATTTCATCTGGGGTGTCATAGGAAAACAGGGATATCAATGTCAAGTTTGCACTTGCGTTGTCCACAAGCG
ATGTCATGAGCTCATTATTACAAAGTGCGCTGGGCTGAAGAAACAGGAAACCCCTGACGAGGTGGGCTCC
CAACGGTTCAGCGTCAACATGCCCCACAAGTTCGGGATCCACAACTACAAGGTCCCCACGTTCTGTGACC
ACTGTGGGTCCCTGCTCTGGGGCCTCTTGCGGCAGGGCTTGCAGTGTAAAGTCTGCAAAATGAATGTTCA
CCGGCGATGTGAGACCAATGTGGCTCCCAACTGTGGGGTAGACGCCAGAGGAATTGCCAAAGTGCTGGCT
GACCTTGGTGTTACTCCAGACAAAATCACCAACAGTGGCCAAAGGAGGAAAAAGCTCGCTGCTGGTGCTG
AGTCCCCACAGCCGGCTTCTGGAAACTCCCCATCTGAAGACGACCGATCCAAGTCAGCGCCCACCTCCCC
TTGTGACCAGGAACTAAAAGAACTTGAAAACAACATTCGGAAGGCCTTGTCATTTGACAACCGAGGAGAG
GAGCACCGAGCGTCGTCGGCCACCGATGGCCAGCTGGCAAGCCCCGGAGAGAACGGGGAAGTCCGGCCAG
GCCAGGCCAAGCGCTTGGGGCTGGATGAGTTCAACTTCATCAAGGTGTTGGGCAAAGGCAGCTTTGGCAA
GGTCATGTTGGCGGAACTCAAAGGCAAAGATGAAGTCTACGCTGTGAAGGTCTTGAAGAAGGACGTTATC
CTACAAGACGATGATGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89306. Forward Primer - name:089306_F_cDNA_Prkce, sequence:ATTTCATCTGGGGTGTCATAGG; Reverse Primer - name:089306_N_SP6_cDNA_Prkce, sequence:CCACATCATCGTCTTGTAGGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8495 same embryo
 EMAGE:8496 same embryo
 EMAGE:8493 same embryo
 EMAGE:8494 same embryo
 EMAGE:8492 same embryo
 EurExpress:euxassay_009722 same experiment
 MGI:4827422 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS