Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8605

Atp8a2 ATPase, aminophospholipid transporter-like, class I, type 8A, member 2 ( MGI:1354710)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605
"Pseudo-wholemount" of euxassay_009705. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009705_01 euxassay_009705_02 euxassay_009705_03 euxassay_009705_04
EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605
euxassay_009705_05 euxassay_009705_06 euxassay_009705_07 euxassay_009705_08 euxassay_009705_09
EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605
euxassay_009705_10 euxassay_009705_11 euxassay_009705_12 euxassay_009705_13 euxassay_009705_14
EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605
euxassay_009705_15 euxassay_009705_16 euxassay_009705_17 euxassay_009705_18 euxassay_009705_19
EMAGE:8605 EMAGE:8605 EMAGE:8605 EMAGE:8605
euxassay_009705_20 euxassay_009705_21 euxassay_009705_22 euxassay_009705_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8605Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8605_wholemount_strong.wlz
8605_wholemount_moderate.wlz
8605_wholemount_weak.wlz
8605_wholemount_possible.wlz
8605_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8605_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 17 18
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 08 09 16 17 moderate expression: see section 10
metencephalon rest of alar plate mantle layer
strong strong
regionalstrong expression: see section 07 18
midbrain mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 09 moderate expression: see section 08 19 20
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 09 18 moderate expression: see section 07 08 19 20
trigeminal v nerve
weak weak
regionalweak expression: see section 10 17
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 18
thoracic ganglion
weak weak
regionalweak expression: see section 11 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 moderate expression: see section 07 08 19
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35965
Entity Detected:Atp8a2, ATPase, aminophospholipid transporter-like, class I, type 8A, member 2 ( MGI:1354710)
Sequence:sense strand is shown

>T35965
TTGGTCAAAGGAGCTAAGAAGCTTGGCTTTGTGTTTACCGGGAGGACGCCGTACTCGGTCATCATCGAAG
CGATGGGACAAGAACAGACATTCGGGATCCTCAATGTTCTAGAATTTTCTAGTGACAGGAAAAGAATGTC
TGTCATTGTCCGACTGCCATCAGGACAACTTCGACTCTACTGCAAGGGAGCCGATAACGTCATCTTTGAA
AGACTCTCAAAGGACTCAAAGTACATGGAGGAGACGCTATGCCATCTGGAATATTTTGCCACAGAAGGCC
TGCGGACTCTGTGCGTGGCCTACGCAGACCTTTCTGAGAATGAGTATGAGGAGTGGCTGAAAGTCTATCA
AGAGGCCAGCATCATTCTGAAGGACAGAGCCCAGAGGCTGGAAGAGTGTTACGAGATCATTGAGAAGAAT
TTACTGTTACTTGGAGCTACAGCCATCGAAGACCGTCTTCAAGCCGGCGTTCCAGAAACCATAGCCACTC
TGCTGAAGGCAGAAATCAAAATCTGGGTGTTGACAGGAGACAAACAAGAAACTGCAATTAATATCGGGTA
TTCCTGTCGGTTGGTGTCGCAGAACATGGCCCTTATCCTATTGAAGGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99989. Forward Primer - name:099989_F_cDNA_Atp8a2, sequence:TTGGTCAAAGGAGCTAAGAAGC; Reverse Primer - name:099989_N_SP6_cDNA_Atp8a2, sequence:CTCCTTCAATAGGATAAGGGCCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8602 same embryo
 EMAGE:8604 same embryo
 EMAGE:8600 same embryo
 EMAGE:8603 same embryo
 EMAGE:8601 same embryo
 EurExpress:euxassay_009705 same experiment
 MGI:4823344 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS