Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8607

Nid1 nidogen 1 ( MGI:97342)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607
"Pseudo-wholemount" of euxassay_009707. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009707_01 euxassay_009707_02 euxassay_009707_03 euxassay_009707_04
EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607
euxassay_009707_05 euxassay_009707_06 euxassay_009707_07 euxassay_009707_08 euxassay_009707_09
EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607
euxassay_009707_10 euxassay_009707_11 euxassay_009707_12 euxassay_009707_13 euxassay_009707_14
EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607
euxassay_009707_15 euxassay_009707_16 euxassay_009707_17 euxassay_009707_18 euxassay_009707_19
EMAGE:8607 EMAGE:8607 EMAGE:8607 EMAGE:8607
euxassay_009707_20 euxassay_009707_21 euxassay_009707_22 euxassay_009707_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8607Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8607_wholemount_strong.wlz
8607_wholemount_moderate.wlz
8607_wholemount_weak.wlz
8607_wholemount_possible.wlz
8607_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8607_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 20 21
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 16 17 18 19 20 21 22 23
vibrissa
strong strong
regionalstrong expression: see section 02 03 04 14 15 16 moderate expression: see section 01 05 17
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11 17 moderate expression: see section 10 16
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 20 21
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons ventricular layer
strong strong
regionalstrong expression: see section 08 17
midbrain meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
trigeminal v nerve maxillary division
moderate moderate
regionalmoderate expression: see section 03 04 05 15 16
dorsal grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 17 18 19 20
lens
strong strong
regionalstrong expression: see section 22 23
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
axial skeleton cervical region
moderate moderate
regionalmoderate expression: see section 06 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36687
Entity Detected:Nid1, nidogen 1 ( MGI:97342)
Sequence:sense strand is shown

>T36687
AGTTACGTGAGTCCCTTCCAAAAAAAAAATCAGGATAAAAATTATGTGTCCATTCTAGAGCCATAGGACT
TCTTCCTAATTCTAGACTCTCCCATGGTAAGCAGAGCCTTAGAGACCTAAGGAGGCTACTTCTTGGTGGC
ATTACAAACTCAGATATTACCCAGTTTCTCAACATACCACCCAGATCCAGCTTAGGCAAGGTCATACTTT
TTCTCTTGGTTATGCTCCCATCTAACTACTCTCCTGTTGTATACCTTCATTCTGCCCAAGACTGCTTTCA
GTGCCTTCTCTGCCATATGATCAAAACCCAACCATATTCCAGGGATTCATGGTATTTGGTAGATGGTAAA
AAGCAACCCCTCCCAAATTACAAAGTCCTGGCATTTCAGCAGTGGCCATTGATAATCACATAGGTAAGTC
AAGGAAAAGTCCTGAGAGAGGGATTTGAAGTCAAAATGTTTGAAGATAGGAGATTATTATCTTGATGTGT
CTTGAATTGTAGCAAATTCTTCTTCTTTGCCAAAGTACCTGTATTAGTTTCTGGTCTATGACGTCATGGG
AATCTTCAGCCCACTCCTGGTACCAGTTTTCAAGTCTTCTCATGGAGAGTCATCTGGAGCTCAGGTTGGG
GTAGGACTTTGACAAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90271. Forward Primer - name:090271_F_cDNA_Nid1, sequence:AGTTACGTGAGTCCCTTCCAAA; Reverse Primer - name:090271_N_SP6_cDNA_Nid1, sequence:TTTGTCAAAGTCCTACCCCAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8611 same embryo
 EMAGE:8606 same embryo
 EMAGE:8609 same embryo
 EMAGE:8610 same embryo
 EMAGE:8608 same embryo
 EurExpress:euxassay_009707 same experiment
 MGI:4826710 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS