Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:861

Pitx1 paired-like homeodomain transcription factor 1 ( MGI:107374)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:861 EMAGE:861
Figure 2E of Lanctot et al., 1997 [PMID:9226452] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 2D of Lanctot et al., 1997 [PMID:9226452] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image D is a brightfield image of the section shown in Image E. Image annotations: arrowhead - junction between ectoderm and endoderm in the mouth; II - 2nd branchial arch; he - heart; md - mandibular component of 1st branchial arch; oe - oral epithelium.
Expression Pattern Description
Spatial Annotation:
EMAGE:861EMAGE:861Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
861_voxel_strong_3D_1.wlz
861_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:861_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch mandibular component
detected detected
regionalThe epithelium of the mandibular arch is only labelled in its inner half.
1st branchial arch maxillary component
detected detected
regionalThe epithelium of the maxillary component is labelled; signal decreases toward the midline.
4th branchial arch
not detected not detected
No other labelling in the mesenchyme of the maxillary component or in other branchial arches.
1st branchial arch maxillary component mesenchyme
not detected not detected
No other labelling in the mesenchyme of the maxillary component or in other branchial arches.
3rd branchial arch
not detected not detected
No other labelling in the mesenchyme of the maxillary component or in other branchial arches.
2nd branchial arch
not detected not detected
No other labelling in the mesenchyme of the maxillary component or in other branchial arches.
oral region epithelium
strong strong
regionalSignal is restricted to tissues of stomodeal origin; ends precisely at the junction between ectoderm and endoderm.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2150936
Entity Detected:Pitx1, paired-like homeodomain transcription factor 1 ( MGI:107374)
Sequence:sense strand is shown

>MGI:2150936
GGGAGCCGCTGGAGAACTCCGCCAGCGAATCGTCCGACGCTGATCTGCCAGACAAGGAGCGCGGTGGGGA
AGCCAAGGGGCCAGAGGATGGTGGCGCGGGCAGTGCTGGCTGCGGCGGCGGTGCAGAGGACCCAGCTAAG
AAGAAGAAACAGCGGCGGCAACGCACTCACTTCACAAGCCAGCAGTTGCAAGAGCTGGAGGCCACGTTCC
AAAGGAACCGCTACCCCGACATGAGCATGAGAGAGGAGATCGCGGTGTGGACCAACCTCACTGAACCGCG
AGTGCGGGTCTGGTTCAAGAACCGGCGAGCCAAATGGCGCAAGCGGGAGCGGAACCAGCAGTTGGACCTG
TGCAAGGGCGGCTATGTGCCGCAGTTCAGCGGCCTGGTGCAGCCCTACGAGGACGTGTACGCTGCCGGCT
ACTCCTACAACAACTGGGCGGCCAAGAGCCTGGCCCCGGCGCCGCTGTCTACCAAGAGCTTTACCTTCTT
CAACTCCATGAGCCCGCTCTCCTCTCAATCCATGTTCTCGGCCCCCAGCTCCATCTCTTCCATGACCATG
CCGTCCAGCATGGG
nt 604 - nt 1177 of U71206.1
Notes:The probe used in this study by Lanctot et al., 1997 [PMID:9226452] is described as follows: "Two cDNA fragments were transcribed into cRNA probes: a 573 nt fragment (from nt 604-1177) encompassing the homeodomain and a 310 nt fragment encoding the last 14 amino acids and 268 bp of 3' untranslated region. Most figures presented here were obtained using the longest cRNA probe because it gave a stronger signal; however, labelling was identical with the 3' probe".
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:CBA x C57BL/6
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Lanctot et al., 1997 [PMID:9226452] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9226452] Lanctot C, Lamolet B, Drouin J 1997 The bicoid-related homeoprotein Ptx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development (124):2807-17
Links:MGI:2151020 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI