Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:862

Pitx1 paired-like homeodomain transcription factor 1 ( MGI:107374)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:862 EMAGE:862
Figure 6D of Lanctot et al., 1997 [PMID:9226452] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 6C of Lanctot et al., 1997 [PMID:9226452] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image C is a brightfield imange of the section shown in Image D. Image annotations: hg - hindgut; nt - neural tube/plate; sp - splanchnic layer of lateral plate mesoderm; uv - umbilical vessels.
Expression Pattern Description
Spatial Annotation:
EMAGE:862EMAGE:862Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
862_voxel_strong_3D_1.wlz
862_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:862_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme derived from somatopleure
detected detected
Expression in the posterior region of the embryo is specific to the lateral plate mesoderm; expression in the thickened somatic mesoderm (body wall) and splanchnic mesoderm .
mesenchyme derived from splanchnopleure
detected detected
Expression in the posterior region of the embryo is specific to the lateral plate mesoderm; expression in the thickened somatic mesoderm (body wall) and splanchnic mesoderm .
umbilical artery embryonic part
detected detected
Authors report expression in umbilical vessels.
umbilical vein embryonic part
detected detected
Authors report expression in umbilical vessels.
umbilical artery extraembryonic part
detected detected
Authors report expression in umbilical vessels.
umbilical vein extraembryonic part
detected detected
Authors report expression in umbilical vessels.
hindgut epithelium
not detected not detected
No labelling in hindgut endoderm.
embryo ectoderm
not detected not detected
In the posterior end of the embryo, no labelling in ectoderm, endoderm, notochord, somites or nephrogenic duct.
trunk somite
not detected not detected
In the posterior end of the embryo, no labelling in ectoderm, endoderm, notochord, somites or nephrogenic duct.
notochord
not detected not detected
In the posterior end of the embryo, no labelling in ectoderm, endoderm, notochord, somites or nephrogenic duct.
nephric duct
not detected not detected
In the posterior end of the embryo, no labelling in ectoderm, endoderm, notochord, somites or nephrogenic duct.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2150936
Entity Detected:Pitx1, paired-like homeodomain transcription factor 1 ( MGI:107374)
Sequence:sense strand is shown

>MGI:2150936
GGGAGCCGCTGGAGAACTCCGCCAGCGAATCGTCCGACGCTGATCTGCCAGACAAGGAGCGCGGTGGGGA
AGCCAAGGGGCCAGAGGATGGTGGCGCGGGCAGTGCTGGCTGCGGCGGCGGTGCAGAGGACCCAGCTAAG
AAGAAGAAACAGCGGCGGCAACGCACTCACTTCACAAGCCAGCAGTTGCAAGAGCTGGAGGCCACGTTCC
AAAGGAACCGCTACCCCGACATGAGCATGAGAGAGGAGATCGCGGTGTGGACCAACCTCACTGAACCGCG
AGTGCGGGTCTGGTTCAAGAACCGGCGAGCCAAATGGCGCAAGCGGGAGCGGAACCAGCAGTTGGACCTG
TGCAAGGGCGGCTATGTGCCGCAGTTCAGCGGCCTGGTGCAGCCCTACGAGGACGTGTACGCTGCCGGCT
ACTCCTACAACAACTGGGCGGCCAAGAGCCTGGCCCCGGCGCCGCTGTCTACCAAGAGCTTTACCTTCTT
CAACTCCATGAGCCCGCTCTCCTCTCAATCCATGTTCTCGGCCCCCAGCTCCATCTCTTCCATGACCATG
CCGTCCAGCATGGG
nt 604 - nt 1177 of U71206.1
Notes:The probe used in this study by Lanctot et al., 1997 [PMID:9226452] is described as follows: "Two cDNA fragments were transcribed into cRNA probes: a 573 nt fragment (from nt 604-1177) encompassing the homeodomain and a 310 nt fragment encoding the last 14 amino acids and 268 bp of 3' untranslated region. Most figures presented here were obtained using the longest cRNA probe because it gave a stronger signal; however, labelling was identical with the 3' probe".
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:CBA x C57BL/6
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Lanctot et al., 1997 [PMID:9226452] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9226452] Lanctot C, Lamolet B, Drouin J 1997 The bicoid-related homeoprotein Ptx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development (124):2807-17
Links:MGI:2151020 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI