Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8689

Sprr2a1 small proline-rich protein 2A1 ( MGI:1330350)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689
"Pseudo-wholemount" of euxassay_009888. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009888_01 euxassay_009888_02 euxassay_009888_03 euxassay_009888_04
EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689
euxassay_009888_05 euxassay_009888_06 euxassay_009888_07 euxassay_009888_08 euxassay_009888_09
EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689
euxassay_009888_10 euxassay_009888_11 euxassay_009888_12 euxassay_009888_13 euxassay_009888_14
EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689
euxassay_009888_15 euxassay_009888_16 euxassay_009888_17 euxassay_009888_18 euxassay_009888_19
EMAGE:8689 EMAGE:8689 EMAGE:8689 EMAGE:8689
euxassay_009888_20 euxassay_009888_21 euxassay_009888_22 euxassay_009888_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8689Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8689_wholemount_strong.wlz
8689_wholemount_moderate.wlz
8689_wholemount_weak.wlz
8689_wholemount_possible.wlz
8689_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8689_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 11 13 14
not examined not examined
regionalnot examined expression: see section 07
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 weak expression: see section 04
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30947
Entity Detected:Sprr2a1, small proline-rich protein 2A1 ( MGI:1330350)
Sequence:sense strand is shown

>T30947
CACCCAACAGGTGAAGGCCTCCCAGTCATCAGGACCAGGGGAAGTGAAAGAAATCTGTCTCACCAGCTCA
CCGACTCCATAGCAACACTTCCATCCTCCTTTGAAAGCCTGTCTGGATGCAGAAGAATCTTCTCCACCCT
TCATCCTCCATGTGCTTATGATGGCTCCTCACAGAGAAGGCATTGCTCTCAGGCTGATCTCCTGCTGCTT
TCCTGGGGATGCTGAGAATGATCCTTTCTCTTGTTTTTGTACACCAGGGGAAGCACAACAGGTATCTACT
CTGTGCTTTCAGAGGAGCCTTCTCAGCCTGCCTGTTACCTGATCAGGGCAATGGTCACTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4216389), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 35459. Forward Primer - name:035459_F_IRAV28-31_J11_Sprr2a, sequence:CACCCAACAGGTGAAGGC; Reverse Primer - name:035459_R_SP6_IRAV28-31_J11_Sprr2a, sequence:AGCAGTGACCATTGCCCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8687 same assay
 EMAGE:8688 same assay
 EMAGE:8690 same embryo
 EMAGE:8684 same embryo
 EMAGE:8686 same embryo
 EurExpress:euxassay_009888 same experiment
 EMAGE:8685 same embryo
 EMAGE:8683 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS