Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8721

Trnp1 TMF1-regulated nuclear protein 1 ( MGI:1916789)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721
"Pseudo-wholemount" of euxassay_010103. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010103_01 euxassay_010103_02 euxassay_010103_03 euxassay_010103_04
EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721
euxassay_010103_05 euxassay_010103_06 euxassay_010103_07 euxassay_010103_08 euxassay_010103_09
EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721
euxassay_010103_10 euxassay_010103_11 euxassay_010103_12 euxassay_010103_13 euxassay_010103_14
EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721
euxassay_010103_15 euxassay_010103_16 euxassay_010103_17 euxassay_010103_18 euxassay_010103_19
EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721 EMAGE:8721
euxassay_010103_20 euxassay_010103_21 euxassay_010103_22 euxassay_010103_23 euxassay_010103_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8721Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8721_wholemount_strong.wlz
8721_wholemount_moderate.wlz
8721_wholemount_weak.wlz
8721_wholemount_possible.wlz
8721_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8721_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 18 19 20 21 weak expression: see section 04 08 17 22 23
foot
weak weak
regionalweak expression: see section 05 23
fibula
weak weak
regionalweak expression: see section 01 23
tibia
weak weak
regionalweak expression: see section 01 23
femur
weak weak
regionalweak expression: see section 01 02 20 21 22 23 24
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 17 18 19 weak expression: see section 15 16
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 10 11
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15 16
pons mantle layer
weak weak
regionalweak expression: see section 07 08 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 18 moderate expression: see section 04 05 19 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 07 08 17 18 moderate expression: see section 02 03 04 05 06 16 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 07 17 moderate expression: see section 06 18
basal columns
weak weak
regionalweak expression: see section 09 10 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 13 14 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 13 14 moderate expression: see section 07 08 15 16 17
vomeronasal organ
strong strong
regionalstrong expression: see section 11 13 14
mandible
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 08 09 10 16 17 18 19 weak expression: see section 20
maxilla
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 08 09 16 17
cranium
moderate moderate
regionalmoderate expression: see section 21 22 23 weak expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 01 02 03 04 05
tail paraxial mesenchyme
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32106
Entity Detected:Trnp1, TMF1-regulated nuclear protein 1 ( MGI:1916789)
Sequence:sense strand is shown

>T32106
TGACCTCAGTACCCCGGACCCCTGGCTTCCCGAGGCAGGCGAGTCTCCAGGTGCGGGAGGACAGACGGAC
GGACGGATCCAGGTGCTGGCCAGATGGACGGCGTCATCTACGCGGAGGAGTCAGCTGGGGGTCCATGGGG
GGCCCTGAAAGTGACACTAAGCTCCTCAGAGGCTCCACTCTATGGGTCTGGACTGACTTCTGCATTCCGC
ACCTTCTCTGGATACCCCGCCTTCAGGAAGACTTCCAGGACTGACGGTACCCAGTCTCGGCGCCCTCCTC
CCAGGAGCCCTTACAGTGGCAAGGGTCTGGGTCCTGGGAACTTGCTCCACTCTGCATTGCTTCCCATACA
CTGTATTTGCCTTTGCTGATACAGAGGCCCGAGATGCTCTCAGATTAGCCGAGACCGCAGCAAACATTGC
CAGTGTGACTGAGAGAAGAATTTCTTCTTAAAGATAGACTCCTCATTCTGACACGTCACGGAGTCCCTGT
CATCACAAGTCACAGTGTAGCTGGAGTCCCCATCGTCCCTTCTATGTCCAGCAGATCCAGGAGGCCTCTT
GGAGGCAGATCACTGCTGTAGGAAAGCCCCATTTTCCTTTCCCCACTATCCTTGTCCTCCCCCCTGTGAG
TGAGGACATGCCTGTAGCCCCTTGCAGACAATCAGCTGCTGCCTCCTAGGGGGACACTTTTCTCAGGAAG
AGGTGGCAGTAACCTCCAAAGCCAAGTTACATGCAGAAAGGCAAGCCACTTCTTGATGTATCCTGATAGA
GGGAAGGAGGCACATTTACTCCCACACCGCCCAGAACAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6491759), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58399. Forward Primer - name:058399_F_IRAV92_d09_2300002D11Rik, sequence:TGACCTCAGTACCCCGGA; Reverse Primer - name:058399_R_SP6_IRAV92_d09_2300002D11Rik, sequence:TATGTTCTGGGCGGTGTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8725 same embryo
 EMAGE:8726 same embryo
 EMAGE:8724 same embryo
 EMAGE:8722 same embryo
 EMAGE:8723 same embryo
 EurExpress:euxassay_010103 same experiment
 MGI:4828931 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS