Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:873

Hoxc8 homeobox C8 ( MGI:96198)
TS11 (7.5 dpc)
in situ hybridisation

Data Images
EMAGE:873 EMAGE:873
Figure 2A of Gaunt, 1988 [PMID:2904354] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright. Figure 2A of Gaunt, 1988 [PMID:2904354] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Abbreviations used: A, anterior; P, posterior; d, decidual tissue; ect, ectoderm; mes, mesoderm; end, endoderm; arrows indicate the anterior limit of the advancing mesoderm layer; all, allantois; am, amnion; ch, chorion; hf, head fold. The authors refer to this embryo as "late" 7.5 dpc.
Expression Pattern Description
Spatial Annotation:
EMAGE:873EMAGE:873Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
873_voxel_weak_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:873_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
allantois
weak weak
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:11551
Entity Detected:Hoxc8, homeobox C8 ( MGI:96198)
Sequence:sense strand is shown

>MGI:11551
GTCGGCCTTATCGGCAGGAGGGAGGGAGAACTGGGAATAGCAGAGAGGGAAGTTTGTGGGGCTGTGTTGG
GGGGCGGAGCCCCCACCCAGACATAACCAGACTGGGGTTCTGTTCTGTTCAGCTCCTGGGCGGCGCAGCG
GTCGACAAACTTACAGCCGGTATCAGACCTTGGAACTAGAGAAGGAGTTTCTCTTTAATCCTTATTTGAC
CAGAAAGCGCCGGATTGAAGTCTCTCACGCCCTGGGACTGACAGAAAGACAAGTGAAGATTTGGTTCCAG
AATCGAAGGATGAAGTGGAAAAAGGAGAACAACAAGGATAAACTGCCTGGGGC
nt 8519 - nt 8851 of M35603.1
Notes:The Hoxc8 (Hox-3.1) probe used in this study by Gaunt, 1988 [PMID:2877873] 2904354 is indicated as the "330 bp PstI-AvaI homeobox fragment used by Breier et al., 1986 [PMID:null] . This fragment is depicted in Figure 1B of Breier et al as "31-1e".
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:(CBA x C57BL/6)F1
Age:7.5 dpc
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:section
Procedures
Staining procedure:autoradiography
General Information
Authors:Gaunt, 1988 [PMID:2904354] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:2904354] Gaunt SJ 1988 Mouse homeobox gene transcripts occupy different but overlapping domains in embryonic germ layers and organs: a comparison of Hox-3.1 and Hox-1.5. Development (103):135-44
 [ PMID:2877873] Breier G, Bucan M, Francke U, Colberg-Poley AM, Gruss P 1986 Sequential expression of murine homeo box genes during F9 EC cell differentiation. EMBO J (5):2209-15
Links:MGI:1345060 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI