Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8739

Uqcrc1 ubiquinol-cytochrome c reductase core protein 1 ( MGI:107876)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739
"Pseudo-wholemount" of euxassay_009939. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009939_01 euxassay_009939_02 euxassay_009939_03 euxassay_009939_04
EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739
euxassay_009939_05 euxassay_009939_06 euxassay_009939_07 euxassay_009939_08 euxassay_009939_09
EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739
euxassay_009939_10 euxassay_009939_11 euxassay_009939_12 euxassay_009939_13 euxassay_009939_14
EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739
euxassay_009939_15 euxassay_009939_16 euxassay_009939_17 euxassay_009939_18 euxassay_009939_19
EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739 EMAGE:8739
euxassay_009939_20 euxassay_009939_21 euxassay_009939_22 euxassay_009939_23 euxassay_009939_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8739Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8739_wholemount_strong.wlz
8739_wholemount_moderate.wlz
8739_wholemount_weak.wlz
8739_wholemount_possible.wlz
8739_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8739_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 03 04 05 06 19 20 21 22
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 18 19 20
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 21 22 23
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 13 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 18 19
ventral grey horn
strong strong
regionalstrong expression: see section 11 moderate expression: see section 10 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 13 14 15 16 17 18
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 10 11 12 13
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13
right lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31087
Entity Detected:Uqcrc1, ubiquinol-cytochrome c reductase core protein 1 ( MGI:107876)
Sequence:sense strand is shown

>T31087
AGTGCTACTTCGCACCCGCCGCTCGCCGGCCCTGCTGAGGTTACCTGCCTTGCGGGGTACCGCAACCTTC
GCCCAGGCCCTCCAGAGCGTGCCGGAGACCCAGGTCAGCATCTTGGACAACGGGCTGCGTGTGGCCTCGG
AGCAGTCCTCGCATGCTACCTGCACGGTGGGAGTGTGGATTGACGCTGGCAGTCGCTATGAGACTGAGAA
GAACAATGGAGCAGGCTACTTTTTGGAACATCTGGCTTTCAAGGGAACAAAGAATCGGCCTGGCAATGCC
TTAGAGAAGGAGGTAGAGAGTATTGGGGCTCATCTTAATGCCTACAGCACTCGAGAGCACACTGCTTACC
TCATCAAGGCACTGTCCAAGGACCTGCCAAAAGTTGTGGAGCTCCTGGCAGATATCGTGCAGAACAGTAG
TCTGGAAGACTCACAGATCGAGAAGGAACGAGATGTGATCCTGCGGGAGATGCAGGAAAATGACGCCTCC
ATGCAGAACGTGGTCTTTGATTACCTGCATGCGACAGCATTCCAGGGCACACCTCTAGCCCAGGCTGTGG
AGGGGCCCAGTGAGAACGTCAGGAGGCTGTCGCGCACAGACTTGACTGACTACCTCAACAGACATTACAA
AGCCCCCCGGATGGTGCTGGCTGCAGCTGGAGGTGTGGAACACCAGCAGCTGCTGGACCTTGCCCAGAAA
C
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:1400271), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 56217. Forward Primer - name:056217_F_IRAV41_d03_Uqcrc1, sequence:AGTGCTACTTCGCACCCG; Reverse Primer - name:056217_R_SP6_IRAV41_d03_Uqcrc1, sequence:TGTTTCTGGGCAAGGTCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8744 same embryo
 EMAGE:8741 same embryo
 EMAGE:8740 same embryo
 EMAGE:8743 same embryo
 EMAGE:8742 same embryo
 EurExpress:euxassay_009939 same experiment
 MGI:4829115 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS