Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8741

Cck cholecystokinin ( MGI:88297)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741
"Pseudo-wholemount" of euxassay_009905. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009905_01 euxassay_009905_02 euxassay_009905_03 euxassay_009905_04
EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741
euxassay_009905_05 euxassay_009905_06 euxassay_009905_07 euxassay_009905_08 euxassay_009905_09
EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741
euxassay_009905_10 euxassay_009905_11 euxassay_009905_12 euxassay_009905_13 euxassay_009905_14
EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741
euxassay_009905_15 euxassay_009905_16 euxassay_009905_17 euxassay_009905_18 euxassay_009905_19
EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741 EMAGE:8741
euxassay_009905_20 euxassay_009905_21 euxassay_009905_22 euxassay_009905_23 euxassay_009905_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8741Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8741_wholemount_strong.wlz
8741_wholemount_moderate.wlz
8741_wholemount_weak.wlz
8741_wholemount_possible.wlz
8741_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8741_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 21 22 23
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31089
Entity Detected:Cck, cholecystokinin ( MGI:88297)
Sequence:sense strand is shown

>T31089
TGGACCCCAGCCATAGAATAAGTGACCGGGACTACATGGGCTGGATGGATTTTGGCCGGCGCAGTGCCGA
GGACTACGAATACCCATCGTAGTGGGCCAGCGTCTTGGCCCTGCTTGGAGGAGGTGGAATGAGGAAACAA
CCACACATACGACCCCTCGCCTCTAATGTCTGACGTTTTGAGTATCTATTTATTAAGTCCCCAATGTGAA
ATCTGTCCAGAGTGTGCAATGCAGCCACATCTCAGCCTAGCTGTGTGGTCGGAAGGCAGTGTTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:1400830), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 56082. Forward Primer - name:056082_F_IRAV41_e03_Cck, sequence:TGGACCCCAGCCATAGAA; Reverse Primer - name:056082_R_SP6_IRAV41_e03_Cck, sequence:GGAAACACTGCCTTCCGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8744 same embryo
 EMAGE:8740 same embryo
 EMAGE:8739 same embryo
 EMAGE:8743 same embryo
 EMAGE:8742 same embryo
 EurExpress:euxassay_009905 same experiment
 MGI:4823696 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS