Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8761

Homer2 homer homolog 2 (Drosophila) ( MGI:1347354)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761
"Pseudo-wholemount" of euxassay_009975. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009975_01 euxassay_009975_02 euxassay_009975_03 euxassay_009975_04
EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761
euxassay_009975_05 euxassay_009975_06 euxassay_009975_07 euxassay_009975_08 euxassay_009975_09
EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761
euxassay_009975_10 euxassay_009975_11 euxassay_009975_12 euxassay_009975_13 euxassay_009975_14
EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761
euxassay_009975_15 euxassay_009975_16 euxassay_009975_17 euxassay_009975_18 euxassay_009975_19
EMAGE:8761 EMAGE:8761 EMAGE:8761 EMAGE:8761
euxassay_009975_20 euxassay_009975_21 euxassay_009975_22 euxassay_009975_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8761Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8761_wholemount_strong.wlz
8761_wholemount_moderate.wlz
8761_wholemount_weak.wlz
8761_wholemount_possible.wlz
8761_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8761_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16 17
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16
facial vii ganglion
strong strong
regionalstrong expression: see section 05 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 16 17
ventral grey horn
strong strong
regionalstrong expression: see section 09 10 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 14 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
vomeronasal organ
strong strong
regionalstrong expression: see section 11
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
right lung
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31130
Entity Detected:Homer2, homer homolog 2 (Drosophila) ( MGI:1347354)
Sequence:sense strand is shown

>T31130
TGGCACAGACGACGAAAAGGCCTCTCACGCGAGCCCAGCCGACACTCACCTCAAGTCTGAGAATGACAAG
CTGAAGATCGCGCTGACACAGAGTGCTGCCAATGTGAAGAAGTGGGAGATGGAGCTGCAGACCCTGCGGG
AGAGCAACGCCCGGCTGACCACGGCACTGCAGGAGTCGGCGGCCAGCGTGGAGCAGTGGAAGCGGCAGTT
CTCCATCTGCAGGGACGAGAATGACAGGCTCCGCAGCAAGATCGAGGAGCTGGAAGAACAGTGCAGCGAG
ATAAACAGGGAGAAGGAGAAGAACACACAGCTGAAGAGGAGGATCGAGGAGCTGGAGTCAGAGGTCCGAG
ACAAGGAGATGGAGTTGAAAGATCTCCGAAAACAGAGTGAAATCATACCTCAGCTCATGTCCGAGTGTGA
ATATGTCTCTGAGAAGTTAGAGGCGGCCGAAAGAGACAATCAAAACTTGGAAGACAAAGTGCGGTCTCTA
AAGACAGACATCGAGGAGAGTAAATACCGACAGCGCCACCTGAAGGGGGAGCTGAAGAGCTTCCTTGAGG
TGCTGGATGGAAAGATCGACGACCTCCATGACTTCCGTAGAGGACTCTCCAAGTTAGGCACAGATAACTA
GGGCGGGGCGGAGCAAGTGTGTGTGAGAGGTGTGGTAGACGTAGGACATTCTCCATTTGCTTCTGTAAAT
GCAGGTGCGATCTGTCTGTCTCCAGACCAATTGTGCCGTCCGCTCACTCCTCCAGAATAGGAAATCTCTC
GCTTCTCTGGCTTTGTGAGGTCATGGACAGCTGGAAGCTTCTGACTCAGGAATCCAGAACTTGGTCTACC
TTAGCCGTTTACGCAGTCAGGGCAGGGATGTTTAGATCTTCCCTTAAGGGCTGTTGTAACCCTATGAACC
GGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:1395337), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57446. Forward Primer - name:057446_F_IRAV43_g04_Homer2, sequence:TGGCACAGACGACGAAAA; Reverse Primer - name:057446_R_SP6_IRAV43_g04_Homer2, sequence:TCCCCGGTTCATAGGGTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8762 same embryo
 EMAGE:8763 same embryo
 EurExpress:euxassay_009975 same experiment
 MGI:4825406 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS