Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:878

Pdgfa platelet derived growth factor, alpha ( MGI:97527)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:878 EMAGE:878
Figure 5K of Orr-Urtreger & Lonai, 1992 [PMID:1451656] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 5I of Orr-Urtreger & Lonai, 1992 [PMID:1451656] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image I is a brightfield image of the section shown in Image K. Image annotations: ma - mandibular arch; my - myelocoel; ov - otic vesicle; ph - pharynx; se - surface ectoderm.
Expression Pattern Description
Spatial Annotation:
EMAGE:878EMAGE:878Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
878_voxel_strong_3D_1.wlz
878_voxel_moderate_3D_1.wlz
878_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:878_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch mandibular component ectoderm
detected detected
Expression in the surface ectoderm of the mandibular arch
pharynx epithelium
detected detected
Expression in the endothelium of the pharynx
otocyst
detected detected
regionalExpression in the lining of the otic vesicle
surface ectoderm
detected detected
regionalExpression is along the entire surface ectoderm but stops where fusion of the mandibular arches take place.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1929690
Entity Detected:Pdgfa, platelet derived growth factor, alpha ( MGI:97527)
Sequence:sense strand is shown

>MGI:1929690
AGGAAGCCATTCCTGCAGTTTGCAAGACCAGGACGGTCATTTACGAGATACCTCGGAGCCAGGTGGACCC
CACATCGGCCAACTTCCTGATCTGGCCCCCATGTGTGGAGGTGAAGCGCTGCACTGGCTGTTGTAACACC
AGCAGCGTCAAGTGCCAGCCTTCACGGGTCCACCACCGCAGTGTCAAG
nt 328 - nt 515 of M29464.1
Notes:The Pdgfa probe used in this study by Orr-Urtreger & Lonai, 1992 [PMID:1451656] is described as follows, "a probe for PDGF-A was isolated by PCR, using first strand cDNA prepared from poly-A rich RNA isolated from embryos 12.5 days (p.c.) (Todd et al., 1987 [PMID:3309680] ) as template. The PCR primers used were synthesized from the fourth exon of murine PDGF-A, on the basis of the cDNA sequence of Mercola et al., 1990 [PMID:2155144] . They were: 5'-AGGAAGCCATTCCTGCA-3' and 5'-CTTGACACTGCGGTG-3'. A 189 bp long DNA fragment synthesized by PCR was cloned into Bluescript II KS+ and the identity of its sequence was confirmed.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:C57BL/6J
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
Staining procedure:autoradiography
General Information
Authors:Orr-Urtreger & Lonai, 1992 [PMID:1451656] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:1451656] Orr-Urtreger A, Lonai P 1992 Platelet-derived growth factor-A and its receptor are expressed in separate, but adjacent cell layers of the mouse embryo. Development (115):1045-58
 [ doi:10.1038/329599a0] [ PMID:3309680] Todd JA, Bell JI, McDevitt HO 1987 HLA-DQ beta gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature (329):599-604
 [ doi:10.1016/0012-1606(90)90181-H] [ PMID:2155144] Mercola M, Wang CY, Kelly J, Brownlee C, Jackson-Grusby L, Stiles C, Bowen-Pope D 1990 Selective expression of PDGF A and its receptor during early mouse embryogenesis. Dev Biol (138):114-22
Links:MGI:1929707 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI