Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:879

Kdr kinase insert domain protein receptor ( MGI:96683)
TS20 (12.5 dpc)
in situ hybridisation

Data Images
EMAGE:879 EMAGE:879 EMAGE:879 EMAGE:879
Figure 9D of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Figure 9A of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Figure 9F of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Figure 9I of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
A and D are roughly corresponding bright and dark-field images. I and F are high power images of A and D. Abbreviations: A, atrium; C, compact layer; E, endocardial cushion; Ep, epicardium; LV, left ventricle; T, trabeculae.
Expression Pattern Description
Spatial Annotation:
EMAGE:879EMAGE:879Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
879_voxel_strong_3D_1.wlz
879_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:879_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
left ventricle endocardial lining
detected detected
flk-1 (Kdr) was expressed in the endocardium
left atrium auricular region endocardial lining
detected detected
flk-1 (Kdr) was expressed in the endocardium
interventricular septum endocardial lining
detected detected
flk-1 (Kdr) was expressed in the endocardium
right atrium auricular region endocardial lining
detected detected
flk-1 (Kdr) was expressed in the endocardium
right atrium endocardial lining
detected detected
flk-1 (Kdr) was expressed in the endocardium
left atrium endocardial lining
detected detected
flk-1 (Kdr) was expressed in the endocardium
right ventricle endocardial lining
detected detected
flk-1 (Kdr) was expressed in the endocardium
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:14717
Entity Detected:Kdr, kinase insert domain protein receptor ( MGI:96683)
Sequence:sense strand is shown

>MGI:14717
TTGGCTCACAGGCAACATCGGTCCACATGGGCGAATCACTCACACCAGTTTGCAAGAACTTGGATGCTCT
TTGGAAACTGAATGGCACCATGTTTTCTAACAGCACAAATGACATCTTGATTGTGGCATTTCAGAATGCC
TCTCTGCAGGACCAAGGCGACTATGTTTGCTCTGCTCAAGATAAGAAGACCAAGAAAAGACATTGCCTGG
TCAAACAGCTCATCATCCTAGAGCGCATGGCACCCATGATCACCGGAAATCTGGAGAATCAGACAACAAC
CATTGGCGAGACCATTGAAGTGACTTGCCCAGCATCTGGAAATCCTACCCCACACATTACATGGTTCAAA
GACAACGAGACCCTGGTAGAAGATTCAGGCATTGTACTGAGAGATGGGAACCGGAACCTGACTATCCGCA
GGGTGAGGAAGGAGGATGGAGGCCTCTACACCTGCCAGGCCTGCAATGTCCTTGGCTGTGCAAGAGCGGA
GACGCTCTTCATAATAGAAGGTGCCCAGGAAAAGACCAACTTGGAAGTCATTATCCTCGTCGGCACTGCA
GTGATTGCCATGTTCTTCTGGCTCCTTCTTGTCATTCTCGTACGGACCGTTAAGCGGGCCAATGAAGGGG
AACTGAAGACAGGCTACTTGTCTATTGTCATGGATCCAGATGAATTGCCCTTGGATGAGCGCTGTGAACG
CTTGCCTTATGATGCCAGCAAGTGG
nt 1958 - nt 2682 of X59397.1
Notes:The Kdr (flk-1) probe used in this study by Moens et al, 1993 [PMID:8287798] is described as "flk-1: an 800 bp fragment spanning the transmembrane domain and part of the extracellular ligand-binding domain (Yamaguchi et al., 1993 [PMID:8223275] )". Yamaguchi et al in turn describe the probe as "a partial flk-1 cDNA", "corresponding to nt 1958 to 2682 according to the nomenclature of Matthews et al, 1991 [PMID:1717995] . GenBank sequence X59397 is the same as appears in Matthews et al (in Fig 1).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:12.5 dpc
Theiler Stage:TS20
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:10% formalin
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Moens et al, 1993 [PMID:8287798] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8287798] Moens CB, Stanton BR, Parada LF, Rossant J 1993 Defects in heart and lung development in compound heterozygotes for two different targeted mutations at the N-myc locus. Development (119):485-99
 [ PMID:8223275] Yamaguchi TP, Dumont DJ, Conlon RA, Breitman ML, Rossant J 1993 flk-1, an flt-related receptor tyrosine kinase is an early marker for endothelial cell precursors. Development (118):489-98
Links:MGI:1276350 same experiment
 EMAGE:258 same embryo
 EMAGE:717 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI