Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:888

Hoxb8 homeobox B8 ( MGI:96189)
TS11 (Early headfold Downs & Davies)
in situ hybridisation

Data Images
EMAGE:888 EMAGE:888 EMAGE:888 EMAGE:888
Figure 1G of Forlani et al., 2003 [PMID:12835396] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright. Figure 1H of Forlani et al., 2003 [PMID:12835396] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright. Figure 1I of Forlani et al., 2003 [PMID:12835396] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright. Figure 1J of Forlani et al., 2003 [PMID:12835396] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
All specimens shown are TS11 and text annotation in this EMAGE entry refers to all of these samples collectively but only the data from specimen H has been spatially mapped in this EMAGE entry as this sample morphologically matches the EMAP TS11 model (#1). Embryo stages (Downs and Davies staging) are: (G) late neural plate (LNP); (H,I) early headfold (EHF); (J) late headfold (LHF). Image annotations: Line in (G) = extent of the primitive streak; arrowheads = rostral front of expression; n, node. Anterior is towards the left; posterior towards the right.
Expression Pattern Description
Spatial Annotation:
EMAGE:888Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
888_wholemount_strong_3D_1.wlz
888_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:888_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo mesoderm
detected detected
regionalTranscripts remained mainly restricted to the primitive streak and nascent mesoderm.
primitive streak
detected detected
regionalTranscripts remained mainly restricted to the primitive streak and nascent mesoderm. Transcripts reached the anterior end of the streak.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1339294
Entity Detected:Hoxb8, homeobox B8 ( MGI:96189)
Sequence:sense strand is shown

>MGI:1339294
TCGGCCCCGCGAGCGACGCAGGAGCTGGGCCTCCCACAGCAGCGTCCCCCGCCGCGCCAGTCCCCGCTAG
TGGTAGTATCTCGTAATAGCTTCTGTGTGTGAGCTACCGTGGATCTCCTTCCCTTGCTTCTGTGTGTGAG
CTACCGTGGATCTCCTTCCCTTCTCTTGGGGGTCCGGGGGGAAAAAAAGAAAAGGATTTTAAGCAAGGAC
TCTTAAGCAAGGACTCCCTCGTCCTGCGAGGGTGATCGACTGCGGCCTGGCAGAACCCCCTCGCCCCCGC
CCCATGTAAAAAAGCCTCCTTGTGCAATGGTCTGTTTCCTTTGAACGTGCTTCTTTGTAATGACCGAGGT
AC
nt 1886 - nt 2237 of NM_010461.1
Notes:The probe used in study by Forlani et al., 2003 [PMID:12835396] is described as a "1:1 mix of a SP6 polymerase transcript from a 350 bp 3' untranslated SacI-KpnI cDNA fragment and a SP6 polymerase transcript from a 420 bp SacI fragment containing the first exon of the gene (Charit� et al., 1994 [PMID:7915198] )". The GenBank ID and co-ordinates above indicating the sequence refer only to the first of these probes.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:(C57BL/6J x CBA)F1
Age:Early headfold Downs & Davies
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Forlani et al., 2003 [PMID:12835396] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/dev.00573] [ PMID:12835396] Forlani S, Lawson KA, Deschamps J 2003 Acquisition of Hox codes during gastrulation and axial elongation in the mouse embryo. Development (130):3807-19
 [ doi:10.1016/0092-8674(94)90524-X] [ PMID:7915198] Charite J, de Graaff W, Shen S, Deschamps J 1994 Ectopic expression of Hoxb-8 causes duplication of the ZPA in the forelimb and homeotic transformation of axial structures. Cell (78):589-601
Links:MGI:2668657 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI