Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8914

Dvl3 dishevelled 3, dsh homolog (Drosophila) ( MGI:108100)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914
"Pseudo-wholemount" of euxassay_012839. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012839_01 euxassay_012839_02 euxassay_012839_03 euxassay_012839_04
EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914
euxassay_012839_05 euxassay_012839_06 euxassay_012839_07 euxassay_012839_08 euxassay_012839_09
EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914
euxassay_012839_10 euxassay_012839_11 euxassay_012839_12 euxassay_012839_13 euxassay_012839_14
EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914
euxassay_012839_15 euxassay_012839_16 euxassay_012839_17 euxassay_012839_18 euxassay_012839_19
EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914 EMAGE:8914
euxassay_012839_20 euxassay_012839_21 euxassay_012839_22 euxassay_012839_23 euxassay_012839_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8914Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8914_wholemount_strong.wlz
8914_wholemount_moderate.wlz
8914_wholemount_weak.wlz
8914_wholemount_possible.wlz
8914_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8914_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 15 16
pons mantle layer
weak weak
regionalweak expression: see section 08
midbrain mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 17 18
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 08 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 18 19
ventral grey horn
weak weak
regionalweak expression: see section 10 11 13 14 15 18
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 13 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38489
Entity Detected:Dvl3, dishevelled 3, dsh homolog (Drosophila) ( MGI:108100)
Sequence:sense strand is shown

>T38489
ATGTCTCTCAACATCATCACCGTCACTCTCAACATGGAAAAGTATAACTTCTTGGGCATCTCCATTGTGG
GCCAAAGCAATGAGCGAGGTGATGGGGGCATCTACATTGGCTCCATCATGAAGGGTGGGGCTGTGGCAGC
TGATGGACGCATTGAGCCAGGAGATATGCTACTGCAGGTAAATGAGATCAACTTCGAGAACATGAGCAAC
GATGACGCAGTCCGAGTCCTTCGGGAGATTGTGCACAAGCCAGGGCCCATCACTCTGACTGTAGCCAAGT
GCTGGGACCCAAGTCCTCGCGGCTGCTTCACATTACCCCGGAGCGAGCCCATCCGTCCCATTGACCCTGC
AGCCTGGGTCTCTCACACGGCAGCCATGACAGGCACCTTCCCCGCCTATGGCATGAGCCCCTCCTTAAGC
ACCATCACCTCTACCAGCTCCTCCATCACCAGCTCCATCCCTGATACAGAGCGCCTAGATGATTTCCACC
TCTCCATCCACAGTGACATGGCGGCCATCGTAAAAGCCATGGCCTCCCCTGAGTCAGGGTTGGAGGTCCG
AGACCGCATGTGGCTCAAGATTACCATTCCCAATGCTTTCATCGGCTCGGATGTGGTGGACTGGCTGTAC
CACAACGTGGAAGGGTTCACCGAGCGTCGGGAGGCCCGCAAGTATGCTAGCAACCTGTTGAAAGCTGGTT
TCATCCGCCATACCGTCAACAAGATCACGTTCTCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 148961. Forward Primer - name:148961_F_cDNA_Dvl3, sequence:ATGTCTCTCAACATCATCACCG; Reverse Primer - name:148961_N_SP6_cDNA_Dvl3, sequence:CGGAGAACGTGATCTTGTTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8915 same embryo
 EMAGE:8916 same embryo
 EMAGE:8912 same embryo
 EMAGE:8918 same embryo
 EMAGE:8913 same embryo
 EMAGE:8917 same embryo
 EurExpress:euxassay_012839 same experiment
 MGI:4824424 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS