EMAGE mouse gene expression spatial database

EMAGE:8958

Enah enabled homolog (Drosophila) ( MGI:108360)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_012903. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_012903_01	euxassay_012903_02	euxassay_012903_03	euxassay_012903_04

euxassay_012903_05	euxassay_012903_06	euxassay_012903_07	euxassay_012903_08	euxassay_012903_09

euxassay_012903_10	euxassay_012903_11	euxassay_012903_12	euxassay_012903_13	euxassay_012903_14

euxassay_012903_15	euxassay_012903_16	euxassay_012903_17	euxassay_012903_18	euxassay_012903_19

euxassay_012903_20	euxassay_012903_21	euxassay_012903_22	euxassay_012903_23	euxassay_012903_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T38681
Entity Detected:	Enah, enabled homolog (Drosophila) ( MGI:108360)
Sequence:	sense strand is shown >T38681 AATGAACGGCAGTAAGTCACCTGTCATCTCCAGACCCAAATCCACACCTTCATCACAGCCAAGTGCCAAT GGAGTCCAGACAGAAGGCCTTGACTATGACAGGCTGAAGCAGGACATTTTAGATGAGATGAGAAAAGAGC TGGCAAAGCTGAAGGAGGAGCTTATTGACGCAATCAGGCAGGAGCTGAGCAAGTCGAACACTGCATAAAG AAGCAAACTACGGAGGGGCAGGACTTGAATCTGGAGAAAACAAAAATTCCTACAAACAACTCTTAACCCC CAAACTTTTAAGCTGTAAGAAGAAAATGGATACACAGTCAGGAGGGAAGCCGTCAACCTCTGAAAGCCTC AGACAGTGACTCTGGCGATCAGCTGTCCCCTCAGTGTGCTGCTTTATTCTGTCTGACCTTTACCACAGGA TGGAGAATGATATTGGAGTTCCCT
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 155392. Forward Primer - name:155392_F_cDNA_TC1570805, sequence:AATGAACGGCAGTAAGTCACCT; Reverse Primer - name:155392_N_SP6_cDNA_TC1570805, sequence:AGGGAACTCCAATATCATTCTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:8959 same embryo
	EMAGE:8962 same embryo
	EMAGE:8960 same embryo
	EMAGE:8961 same embryo
	EMAGE:8963 same embryo
	EurExpress:euxassay_012903 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source