Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8961

Ywhab tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide ( MGI:1891917)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961
"Pseudo-wholemount" of euxassay_012917. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012917_01 euxassay_012917_02 euxassay_012917_03 euxassay_012917_04
EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961
euxassay_012917_05 euxassay_012917_06 euxassay_012917_07 euxassay_012917_08 euxassay_012917_09
EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961
euxassay_012917_10 euxassay_012917_11 euxassay_012917_12 euxassay_012917_13 euxassay_012917_14
EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961
euxassay_012917_15 euxassay_012917_16 euxassay_012917_17 euxassay_012917_18 euxassay_012917_19
EMAGE:8961 EMAGE:8961 EMAGE:8961 EMAGE:8961
euxassay_012917_20 euxassay_012917_21 euxassay_012917_22 euxassay_012917_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8961Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8961_wholemount_strong.wlz
8961_wholemount_moderate.wlz
8961_wholemount_weak.wlz
8961_wholemount_possible.wlz
8961_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8961_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 15
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 14 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38677
Entity Detected:Ywhab, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide ( MGI:1891917)
Sequence:sense strand is shown

>T38677
TGTGCTCTGTGATCTGTTTGTGTCACTTTGTATCCTCCACATTATGTCCCTTTGTGCGATAAACAAAAAC
AAAAAATCGAATGTGGACTTTCGATTTTTCACAGCCTAAGCCTTGCAAAGATGGTCCCTGGGATGAACAG
CTGGTATTTGTATCTAAAGCTCAGACTGGTCCCTTAATACCATGGTATTGTGAAGTCTTGATTTTGATCA
ACATTGACAAGGATTACTGTGTGTTTAATTTTTACAAACTGAACACTGTGATCATGGGGTTTTATAACTT
AGCAGAACTCTTTCTGGTAGGAATAATAGACCTGAATTATGTGTAACTTCTTGGAAAGTTTAATCTGATA
TCAAAATGGTCACTGAAATACAATTCTGTTGTAAAGCTGTACAGAAAGTTCTAGAGATTCTGTGGTGATG
CTGGGACTTGGTGAGATGCTGACCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 155217. Forward Primer - name:155217_F_cDNA_TC1567445, sequence:TGTGCTCTGTGATCTGTTTGTG; Reverse Primer - name:155217_N_SP6_cDNA_TC1567445, sequence:GTGGTCAGCATCTCACCAAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8959 same embryo
 EMAGE:8958 same embryo
 EMAGE:8962 same embryo
 EMAGE:8960 same embryo
 EMAGE:8963 same embryo
 EurExpress:euxassay_012917 same experiment
 MGI:4829255 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS