Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8992

Eif2c1 eukaryotic translation initiation factor 2C, 1 ( MGI:2446630)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992
"Pseudo-wholemount" of euxassay_012863. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012863_01 euxassay_012863_02 euxassay_012863_03 euxassay_012863_04
EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992
euxassay_012863_05 euxassay_012863_06 euxassay_012863_07 euxassay_012863_08 euxassay_012863_09
EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992
euxassay_012863_10 euxassay_012863_11 euxassay_012863_12 euxassay_012863_13 euxassay_012863_14
EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992
euxassay_012863_15 euxassay_012863_16 euxassay_012863_17 euxassay_012863_18 euxassay_012863_19
EMAGE:8992 EMAGE:8992 EMAGE:8992 EMAGE:8992
euxassay_012863_20 euxassay_012863_21 euxassay_012863_22 euxassay_012863_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8992Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8992_wholemount_strong.wlz
8992_wholemount_moderate.wlz
8992_wholemount_weak.wlz
8992_wholemount_possible.wlz
8992_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8992_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 09 10 11 14 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 11 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16 17 18 19 20 21 22 23 weak expression: see section 02 03 04 05 06 07 08
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15 16
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 06 07 09 10 15 19 20 21
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 04 05 06 07 09 10 11 13 14 15 17 18 19 20 21 22
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 14 15 16 17 18 weak expression: see section 08 09 12 13
facial vii ganglion
weak weak
regionalweak expression: see section 05 19 20 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 16 17 18 19 20 21 22
neural retina
weak weak
regionalweak expression: see section 01 02 21 22 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 15 16 17
lower jaw incisor
weak weak
regionalweak expression: see section 09 10 14
lower jaw molar
weak weak
regionalweak expression: see section 06 17
upper jaw incisor
weak weak
regionalweak expression: see section 09 10
upper jaw molar
weak weak
regionalweak expression: see section 05 06 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38493
Entity Detected:Eif2c1, eukaryotic translation initiation factor 2C, 1 ( MGI:2446630)
Sequence:sense strand is shown

>T38493
CACCTGGCATCTATGAGGTACACCCCTGTGGGCCGCTCCTTCTTCTCACCGCCTGAGGGCTACTACCACC
CGCTGGGGGGTGGGCGCGAGGTCTGGTTCGGCTTTCACCAGTCTGTGCGCCCTGCCATGTGGAAGATGAT
GCTCAACATTGATGTCTCAGCCACTGCCTTCTACAAAGCACAGCCAGTGATTGAGTTCATGTGTGAGGTC
CTGGACATCAGGAACATAGACGAACAACCCAAGCCCCTCACGGATTCCCAGCGTGTTCGGTTTACCAAGG
AGATAAAAGGCCTGAAGGTGGAAGTGACCCACTGTGGACAGATGAAGAGGAAATACCGCGTGTGTAATGT
TACCCGCCGCCCTGCTAGCCATCAGACGTTCCCCTTGCAGCTGGAGAGTGGACAGACTGTGGAGTGCACT
GTGGCACAGCATTTCAAGCAGAAATATAACCTTCAGCTCAAGTATCCTCACCTGCCCTGCCTACAAGTTG
GGCAAGAACAGAAGCATACCTATTTGCCCCTCGAGGTCTGTAACATTGTGGCTGGGCAGCGGTGCATTAA
GAAGCTGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150216. Forward Primer - name:150216_F_cDNA_Eif2c1, sequence:CACCTGGCATCTATGAGGTACA; Reverse Primer - name:150216_N_SP6_cDNA_Eif2c1, sequence:GTCAGCTTCTTAATGCACCGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8994 same embryo
 EMAGE:8997 same embryo
 EMAGE:8995 same embryo
 EMAGE:8993 same embryo
 EMAGE:8991 same embryo
 EMAGE:8996 same embryo
 EurExpress:euxassay_012863 same experiment
 MGI:4824504 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS