Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8993

Lamc2 laminin, gamma 2 ( MGI:99913)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993
"Pseudo-wholemount" of euxassay_012878. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012878_01 euxassay_012878_02 euxassay_012878_03 euxassay_012878_04
EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993
euxassay_012878_05 euxassay_012878_06 euxassay_012878_07 euxassay_012878_08 euxassay_012878_09
EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993
euxassay_012878_10 euxassay_012878_11 euxassay_012878_12 euxassay_012878_13 euxassay_012878_14
EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993
euxassay_012878_15 euxassay_012878_16 euxassay_012878_17 euxassay_012878_18 euxassay_012878_19
EMAGE:8993 EMAGE:8993 EMAGE:8993 EMAGE:8993
euxassay_012878_20 euxassay_012878_21 euxassay_012878_22 euxassay_012878_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8993Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8993_wholemount_strong.wlz
8993_wholemount_moderate.wlz
8993_wholemount_weak.wlz
8993_wholemount_possible.wlz
8993_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8993_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 07 08 16 17 18
thyroid gland
weak weak
regionalweak expression: see section 09 10 14
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 15
naris
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 12 13
esophagus
weak weak
regionalweak expression: see section 11 12
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 17
oral epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 weak expression: see section 10 11 12 14 15 16 19
palatal shelf
weak weak
regionalweak expression: see section 10 11 12 14
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 13 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 18
bladder
weak weak
regionalExpression in the fundus region.
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19 20 weak expression: see section 16
urethra of male
weak weak
spottedweak expression: see section 11 12
lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 23 moderate expression: see section 03 04 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38531
Entity Detected:Lamc2, laminin, gamma 2 ( MGI:99913)
Sequence:sense strand is shown

>T38531
CAGCATCAGAACAGAGTTCAGGATACGAGCAGACTCATCTCTCAGATGCGCCTGAGTCTGGCAGGAAGCG
AAGCTCTCTTGGAAAACACTAATATCCATTCTTCTGAGCACTACGTGGGGCCGAATGATTTTAAAAGTCT
GGCTCAGGAGGCTACAAGAAAGGCAGACAGCCACGCTGAGTCAGCTAACGCAATGAAGCAACTAGCAAGG
GAAACTGAGGACTACTCCAAACAAGCACTTTCATTGGCCCGCAAGCTCTTGAGTGGAGGAGGCGGAAGTG
GCTCTTGGGACAGCTCCGTGGTACAAGGTCTTATGGGAAAATTAGAGAAAACCAAGTCCCTGAGCCAGCA
GCTGTCATTGGAGGGCACCCAAGCCGACATTGAAGCTGATAGGTCGTATCAGCACAGTCTCCGCCTCCTG
GATTCTGCCTCTCAGCTTCAGGGAGTCAGTGATCTGTCCTTTCAGGTGGAAGCAAAGAGGATCAGACAAA
AGGCTGATTCTCTCTCAAACCTGGTGACCAGACAAACGGATGCATTCACGCGTGTGCGAAACAATCTGGG
GAACTGGGAAAAAGAAACACGGCAGCTTTTACAGACTGGAAAGGATAGGAGACAGACTTCAGATCAGCTG
CTTTCCCGTGCCAACCTTGCTAAAAACAGAGCCCAAGAAGCGCTAAGTATGGGCAATGCCACTTTTTATG
AAGTTGAGAACATCCTGAAGAACCTCCGAGAGTTTGATCTGCAGGTTGAAGACAGAAAAGCAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 149896. Forward Primer - name:149896_F_cDNA_Lamc2, sequence:CAGCATCAGAACAGAGTTCAGG; Reverse Primer - name:149896_N_SP6_cDNA_Lamc2, sequence:CTCTGCTTTTCTGTCTTCAACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8992 same embryo
 EMAGE:8994 same embryo
 EMAGE:8997 same embryo
 EMAGE:8995 same embryo
 EMAGE:8991 same embryo
 EMAGE:8996 same embryo
 EurExpress:euxassay_012878 same experiment
 MGI:4825863 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS