EMAGE mouse gene expression spatial database

EMAGE:9007

Olfr374 olfactory receptor 374 ( MGI:3030208)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_013036. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_013036_01	euxassay_013036_02	euxassay_013036_03	euxassay_013036_04

euxassay_013036_05	euxassay_013036_06	euxassay_013036_07	euxassay_013036_08	euxassay_013036_10

euxassay_013036_11	euxassay_013036_12	euxassay_013036_13	euxassay_013036_14	euxassay_013036_15

euxassay_013036_16	euxassay_013036_17	euxassay_013036_18	euxassay_013036_19	euxassay_013036_20

euxassay_013036_21	euxassay_013036_22	euxassay_013036_23	euxassay_013036_24	euxassay_013036_25

euxassay_013036_26

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T39234
Entity Detected:	Olfr374, olfactory receptor 374 ( MGI:3030208)
Sequence:	sense strand is shown >T39234 AGGTCCCCCACTTCTTCTGTGACCTCAGCCCACTTCTGAAGCTAGCCTGTTTAGATACCTCTCTCAATGA CATCATGGTATACACTGTGGGCGCATTGCCCATCATCACCCCCTTCGTGGGCATCTTGACCTCCTACACA CGCATCTTCACAGCAGTGTTGAGGATCCCATCTACAGGAGGGAAATGGAAAGCATTCTCCACCTGTGGCT CCCATCTCTCCGTGGTGTCCCTCTT
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 279434. Forward Primer - name:279434_F_cDNA_Olfr374, sequence:AGGTCCCCCACTTCTTCTGT; Reverse Primer - name:279434_N_SP6_cDNA_Olfr374, sequence:AAGAGGGACACCACGGAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:9008 same embryo
	EMAGE:9004 same embryo
	EMAGE:9005 same embryo
	EMAGE:9009 same embryo
	EMAGE:9006 same embryo
	EurExpress:euxassay_013036 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source