Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9027

D930028M14Rik RIKEN cDNA D930028M14 gene ( MGI:3687343)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027
"Pseudo-wholemount" of euxassay_012908. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012908_01 euxassay_012908_02 euxassay_012908_03 euxassay_012908_04
EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027
euxassay_012908_05 euxassay_012908_06 euxassay_012908_07 euxassay_012908_08 euxassay_012908_09
EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027
euxassay_012908_10 euxassay_012908_11 euxassay_012908_12 euxassay_012908_13 euxassay_012908_14
EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027
euxassay_012908_15 euxassay_012908_16 euxassay_012908_17 euxassay_012908_18 euxassay_012908_19
EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027 EMAGE:9027
euxassay_012908_20 euxassay_012908_21 euxassay_012908_22 euxassay_012908_23 euxassay_012908_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9027Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9027_wholemount_strong.wlz
9027_wholemount_moderate.wlz
9027_wholemount_weak.wlz
9027_wholemount_possible.wlz
9027_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9027_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
telencephalon mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 06 16
spinal cord mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 11 12 13 14 15 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38659
Entity Detected:D930028M14Rik, RIKEN cDNA D930028M14 gene ( MGI:3687343)
Sequence:sense strand is shown

>T38659
TGTACCCCTTACCCCTACCTCTGGGGGGGGCCAGCCATCACCCCATACTCCCCTACTGCAGGAGAGTTTA
GGGGGGCTGAGAGCTTGGAGAGCCAGGAGAGGGGACTCAAAGAAAGAGGAAACACTCAGGAAGGGATGGA
GAGATGGACAGAGCTGAATGCCTGTGGGAAGCACGGAGAGAAGCAGAGGACTATGGGAGGCCAGGAGCAG
GAGACCTGTGGGCCTGGTGAGCGGCACAGACCTCTGCACTCGGTGGGATTCCCAGCAGGCCTCGCTCCAA
GCTCCCAGGGTTACTCTGAGGTCCGCCTATGTTGCGGATCAGAGCTCTGAATTCTCAGCCTGCCTTAATT
TGCTGTGGGACTGTCCAGGATTCCAGGGACTCACGGATCCTAGCCTGATAAAGTCACTGAAGACTCTGCC
TCAAACGGTCCTGGGTTGTTCTTCCAAGTCACCTCCTTAGACCCAGCGATGCAAGGCTTGTCCCCCACAA
GTGAGCTCCAGCTCCTGAGATCTTCAGGGCTCCTGCACGGGGAGTATAGGAGTCTGTCCTCGTCGCCTCC
GTGATGTAGCATGCGGAGGGCTACAGGGGACTGCAACTGGCCACGGGGACTGCAAGGCCAGAGCTGCGTT
CCTGGCTCCAACAGCTGATAAGCCTGTCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 108697. Forward Primer - name:108697_F_cDNA_LOC434147, sequence:TGTACCCCTTACCCCTACCTCT; Reverse Primer - name:108697_N_SP6_cDNA_LOC434147, sequence:TGACAGGCTTATCAGCTGTTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9029 same embryo
 EMAGE:9028 same embryo
 EurExpress:euxassay_012908 same experiment
 MGI:4824213 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS