Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9038

Tmem130 transmembrane protein 130 ( MGI:3607706)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038
"Pseudo-wholemount" of euxassay_012940. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012940_01 euxassay_012940_02 euxassay_012940_03 euxassay_012940_04
EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038
euxassay_012940_05 euxassay_012940_06 euxassay_012940_07 euxassay_012940_08 euxassay_012940_09
EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038
euxassay_012940_10 euxassay_012940_11 euxassay_012940_12 euxassay_012940_13 euxassay_012940_14
EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038
euxassay_012940_15 euxassay_012940_16 euxassay_012940_17 euxassay_012940_18 euxassay_012940_19
EMAGE:9038 EMAGE:9038 EMAGE:9038 EMAGE:9038
euxassay_012940_20 euxassay_012940_21 euxassay_012940_22 euxassay_012940_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9038Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9038_wholemount_strong.wlz
9038_wholemount_moderate.wlz
9038_wholemount_weak.wlz
9038_wholemount_possible.wlz
9038_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9038_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 18 19 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 08 17 19
spinal cord
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 16 17 18 weak expression: see section 13 14 15
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23
nasal cavity olfactory epithelium
moderate moderate
spottedmoderate expression: see section 11 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38183
Entity Detected:Tmem130, transmembrane protein 130 ( MGI:3607706)
Sequence:sense strand is shown

>T38183
TCTTTTAACCTGACCCACGTCTTCCAGGACCCCGGGGACTACTGCTTCATCTTCCGTGCTGAGAATGCTA
TCAGCAAGGCTCACCAGTACCACAGGATTCAGGTGTGGCCCTCCAGCTTCCAGCCATTTGTCTTTGCTTT
CCCGTGTGCCACGCTAATCACCGTGCTGCTGGTTTTTCTCATGTATATGACTGTGCGGAGCGCTGCAACC
CAGAAGGACATCGTGGAGAGCCCAGGGGCCACTGGGCTCAAGTGTTGCTGCCAGGTGTGCTGTGGATCCC
TCTTTCTGGACTCCCCGTCTGAGTACCTGGAAATCGTCCGAGAGAACCACGGGCTGCTTCCACCCCTCTA
CAAACCTGTGAAAACTTACAATGTGTGAACTCCCATCCCATACCTCTCAGTATTCACCGATCACCCATCG
GGAGCTTCGGGCAGGGTGGCCTATGCTACTGAGCAGGAGGGGTTTACACCGGGGTGACCGTTTGCCCAGA
CGGGTCACCGATCTGTACAGTCCAGCTGACATCATTCGTCCTTTGTGTCGCCTCCCCACTGTCATCTACT
CATCCGTACAGTCTAGTCAGTGCTGTAAGCTGTTCCCAGTCACCCTCCCCCACCCCCTCTACCAAGCAGG
ATTCTGATCTTTGGTGTGTTGTGTTAAGACTCTCCCAAGTGGGTCTGGCTGCCCCTTGCCCATTGCTCAC
TGGGGACTACTGAGGTCCCTGGCAATGCAGCTCCGCCCAAGCCAGAAGGAACGAGGAAGGAGGTCACAGA
TGGTTAAGGACAGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105877. Forward Primer - name:105877_F_cDNA_C130036G08, sequence:TCTTTTAACCTGACCCACGTCT; Reverse Primer - name:105877_N_SP6_cDNA_C130036G08, sequence:ATCTGTCCTTAACCATCTGTGAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9036 same embryo
 EMAGE:9037 same embryo
 EurExpress:euxassay_012940 same experiment
 MGI:4828769 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS