Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:911

Actc1 actin, alpha, cardiac muscle 1 ( MGI:87905)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:911
Figure 5C of Tanaka et al., 1999 [PMID:10021345] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Abbreviations used: a, atrium; v, ventricle.
Expression Pattern Description
Spatial Annotation:
EMAGE:911EMAGE:911Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
911_voxel_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:911_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
heart atrium
detected detected
primitive ventricle
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1276342
Entity Detected:Actc1, actin, alpha, cardiac muscle 1 ( MGI:87905)
Sequence:sense strand is shown

>MGI:1276342
AGGCGACTGACACCCAGTGCCTGCCACCAGCGCCAGCCCAGCTGAATCCAGCCGCCCCTAGCACGGTGAG
TCCCAGCCTTGCTCCCTGCAGGACCTTGTCAGCACTGTGCTTTTGTGCTCTTGGATCC
nt 662 - nt 789 of M59866.1
Notes:The probe used in this study by Tanaka et al., 1999 [PMID:10021345] was originally described in Sassoon et al., 1988 [PMID:3075543] ie. as a BamHI genomic fragment which includes the first non-coding exon (see Fig 1B therein). NB. Note that the target sequence for this probe is the reverse and complement of the sequence in the link above (the sequence in M59866 is the reverse strand).
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
General Information
Authors:Tanaka et al., 1999 [PMID:10021345] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10021345] Tanaka M, Chen Z, Bartunkova S, Yamasaki N, Izumo S 1999 The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development. Development (126):1269-80
 [ PMID:3075543] Sassoon DA, Garner I, Buckingham M 1988 Transcripts of alpha-cardiac and alpha-skeletal actins are early markers for myogenesis in the mouse embryo. Development (104):155-64
Links:MGI:1330219 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI